ID: 1033452796

View in Genome Browser
Species Human (GRCh38)
Location 7:141476748-141476770
Sequence GCTGCAAAGCAGAAAGTGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 668}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033452796_1033452802 17 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452802 7:141476788-141476810 GAGGGTGAGACTTCCTTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 125
1033452796_1033452798 -2 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452798 7:141476769-141476791 GCGGATCAAGTGTCCTTGTGAGG 0: 1
1: 0
2: 0
3: 3
4: 59
1033452796_1033452803 21 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452803 7:141476792-141476814 GTGAGACTTCCTTCAAGGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 151
1033452796_1033452804 22 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452804 7:141476793-141476815 TGAGACTTCCTTCAAGGGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 189
1033452796_1033452799 -1 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452799 7:141476770-141476792 CGGATCAAGTGTCCTTGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 56
1033452796_1033452801 16 Left 1033452796 7:141476748-141476770 CCGCACACTTTCTGCTTTGCAGC 0: 1
1: 0
2: 3
3: 77
4: 668
Right 1033452801 7:141476787-141476809 TGAGGGTGAGACTTCCTTCAAGG 0: 1
1: 0
2: 1
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033452796 Original CRISPR GCTGCAAAGCAGAAAGTGTG CGG (reversed) Exonic
900006644 1:60167-60189 GCTGCTGAGCAGAAGGTGTTTGG - Intergenic
900298743 1:1966059-1966081 GCTCCAAAGCTGAAAGGCTGAGG - Intronic
901333802 1:8431172-8431194 GCCACAAAGCAGGAAGTGAGCGG + Intronic
901868871 1:12125912-12125934 GCAGCAAGGCAAAGAGTGTGGGG + Intronic
902221426 1:14968382-14968404 GCTGCACAGCAGGAGGTGAGGGG - Intronic
902942349 1:19809535-19809557 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
903060788 1:20667129-20667151 GCTGCACAGCAGGAAGTGAGCGG + Intronic
903080276 1:20805300-20805322 GCTGCACAACAGAAGGTGAGTGG + Intergenic
903670147 1:25030763-25030785 GTTCCAGAGCAGAAAGTGTGGGG + Intergenic
905027068 1:34858005-34858027 GCTGCACAGCAGGAGGTGAGCGG - Intronic
905688921 1:39928437-39928459 GCTGCACAGCAGAAGGTGAGTGG + Intergenic
906118946 1:43374739-43374761 GCCGCACAGCAGAAGGTGAGTGG - Intergenic
906435668 1:45794340-45794362 GCTGCATGGCAGAAGGTGAGTGG + Intronic
906892399 1:49731075-49731097 GATGAAAGACAGAAAGTGTGAGG + Intronic
908048220 1:60196073-60196095 GCTACATATCAGAAGGTGTGGGG + Intergenic
909346227 1:74590680-74590702 GCTGCACAGCAGGAGGTGAGTGG - Intronic
909695704 1:78465796-78465818 GCTTGAAGGCAGAAGGTGTGGGG + Intronic
910228785 1:84964909-84964931 GCTGCACAGCAGGAGGTGAGTGG - Intronic
910324547 1:85990536-85990558 GCTGCACAGCAGGAAGTGAGTGG - Intronic
910415372 1:86991978-86992000 GCTGCACAGCAGGAGGTGAGTGG + Intronic
910590244 1:88922449-88922471 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
910934255 1:92474587-92474609 GCAGCAAAGGAGAAAGTATATGG + Intergenic
911625972 1:100124963-100124985 GCTGCACAGCAGGAGGTGAGTGG - Intronic
913118278 1:115716630-115716652 GCAGCAAAGCAGAATGTTTGAGG + Intronic
913238853 1:116810421-116810443 GCTGCAATGCAGGCATTGTGAGG + Intergenic
913579407 1:120210907-120210929 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
913628765 1:120687481-120687503 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
914319865 1:146548729-146548751 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
914561341 1:148822334-148822356 GCTGCATAGCAGGAGGTGAGTGG + Intronic
914611493 1:149307874-149307896 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
914717472 1:150264602-150264624 GCTGGAAAACCGAAAGAGTGTGG + Exonic
916124485 1:161557175-161557197 GCTGCACAGCAGGAAGTGAGGGG - Intergenic
916134377 1:161638525-161638547 GCTGCACAGCAGGAAGTGAGGGG - Intronic
916407321 1:164510238-164510260 GAAGCAAAGCAGAAAATATGGGG - Intergenic
916619248 1:166477960-166477982 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
916653351 1:166850605-166850627 GCTGCACAGCAGGAGGTGAGCGG + Exonic
916705655 1:167346711-167346733 GCTGCACAGCAGGAGGTGAGTGG - Intronic
917347925 1:174048053-174048075 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
917489640 1:175487326-175487348 GCTGCACAGCAGGAGGTGAGTGG - Intronic
917562666 1:176175604-176175626 GCTGCACAGCAGGAGGTGAGGGG - Intronic
917633273 1:176910764-176910786 GCTGCACAGCAGGAAGTGAGCGG + Intronic
917773793 1:178311295-178311317 GCTGAAAAGCAAATAGAGTGTGG + Intronic
919073929 1:192791139-192791161 GCTCCAAAGCACAGAGTGAGAGG - Intergenic
919315159 1:195963061-195963083 GCTGCATAGCAGGATGTGAGCGG - Intergenic
919501413 1:198342056-198342078 GCCGCACAGCAGAAGGTGAGGGG - Intergenic
919615253 1:199799283-199799305 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
921357739 1:214302431-214302453 TTTGCAATGCAGAAGGTGTGAGG - Intronic
922010187 1:221575542-221575564 GCTGCACAGCAGGAGGTGAGGGG + Intergenic
922865859 1:228861077-228861099 CCTGCAAAGCAGGGACTGTGCGG + Intergenic
923619466 1:235566268-235566290 GCTGCACAGCAGGAGGTGAGCGG + Intronic
924019159 1:239762419-239762441 GTTGCATAGAACAAAGTGTGTGG + Intronic
1062846385 10:710184-710206 ACTGCAAGGCAGAAAGCGTTGGG - Intergenic
1063506161 10:6601632-6601654 GCTTCACAGCAGAAGGTGAGTGG - Intergenic
1063708776 10:8457004-8457026 TGTTCCAAGCAGAAAGTGTGTGG - Intergenic
1064139033 10:12774673-12774695 GCTGCACAGCAGGAAGTGAGAGG + Intronic
1064291769 10:14040959-14040981 GCTGCAAAGTAGCAAGTGCCAGG + Intronic
1064410957 10:15103600-15103622 GATGCTAAGCAGCAAGTGTCAGG + Exonic
1064871921 10:19946925-19946947 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1065155332 10:22864084-22864106 GCTTCAGAGCAGATACTGTGAGG + Intergenic
1065410518 10:25422267-25422289 GCTGCACAGCAGGAAGTGAGTGG + Intronic
1066080581 10:31928015-31928037 ACCGCAAAGAAGAAAGTGTCCGG + Intronic
1066350870 10:34635874-34635896 GTTGTAAAGCTGACAGTGTGTGG + Intronic
1066541559 10:36452190-36452212 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
1068616776 10:59127197-59127219 GCTACAAAGCACAATGTGTTAGG - Intergenic
1068812640 10:61273906-61273928 GCTGCACAGCAGGAAGTAAGTGG + Intergenic
1070428978 10:76317090-76317112 GCTCCAATGCAGAGAGAGTGTGG + Intronic
1072672290 10:97439319-97439341 GCTGCATAGAAGGAAGTGAGTGG + Intronic
1073232323 10:101982559-101982581 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1073610376 10:104937223-104937245 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1073699205 10:105906636-105906658 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1073746871 10:106479180-106479202 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1073875603 10:107918335-107918357 GCCACATAGCAGAAAGTGAGTGG - Intergenic
1074596078 10:114868237-114868259 GCTGCATAGCAGGAGGTGAGTGG + Intronic
1075131130 10:119740839-119740861 GCTTCAAAGAAAAAAGTATGGGG - Intronic
1075242317 10:120790407-120790429 ACTGCAAAGCAGCAGGAGTGGGG - Intergenic
1075841255 10:125506089-125506111 GCTACAAAGCAGAAAGAGTGGGG - Intergenic
1076868636 10:133181900-133181922 GCCCCAGAGAAGAAAGTGTGGGG + Intronic
1077426475 11:2481552-2481574 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1078278462 11:9874715-9874737 GCTACAAAGCAGTAAATATGGGG + Intronic
1078361165 11:10668964-10668986 GCTGCAAAGCACAGAGTGCTGGG - Intronic
1078380496 11:10835678-10835700 GCTGCACAGCAGGAGGTGAGGGG + Intronic
1078636768 11:13058193-13058215 CCTGGAAAGCAGAAACAGTGTGG - Intergenic
1079357978 11:19745835-19745857 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1079438055 11:20477809-20477831 GCTGCAAAACAGGAAGTGGGGGG - Intronic
1079666052 11:23107009-23107031 GCTGCACAGCAGGAAGTGAGGGG + Intergenic
1079870433 11:25792326-25792348 GCTGCACAGCAGGAAGTGAGTGG + Intergenic
1080031183 11:27662779-27662801 GCTGCACAGTAGGAAGTGAGCGG - Intronic
1080066397 11:28020135-28020157 GCTGCAGAGCAGGAAGCGAGTGG + Intergenic
1080110320 11:28559528-28559550 GTTGGAAAGCAGAAAGAGAGGGG - Intergenic
1080647987 11:34200878-34200900 ACTGCAAACCAGTAAGTTTGTGG - Intronic
1080831502 11:35897354-35897376 GCTACAAAACAGAAAGGGAGAGG + Intergenic
1080832005 11:35903589-35903611 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1081480600 11:43484832-43484854 GCTACACAGCAGAAGGTGAGTGG + Intronic
1081559962 11:44204592-44204614 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1082740833 11:56909210-56909232 GCTGCATAGCAGAAGGTGAGTGG - Intergenic
1082843287 11:57706895-57706917 GCTGAAAAGCATAAAGTATCAGG + Intronic
1082989419 11:59194733-59194755 GCTGCAAAGCATAATGTTTCAGG - Intronic
1084331570 11:68433509-68433531 GCTTCAAAGCAGAAGTTGAGAGG - Intronic
1084549830 11:69834629-69834651 GCTGCAAAGCAAAGGGTGAGGGG + Intergenic
1084648451 11:70474266-70474288 ACTGAAAAGCAGAACGCGTGAGG + Intronic
1084795573 11:71502454-71502476 TCTGGATAGCAGAAAGTGGGGGG + Intronic
1084795588 11:71502532-71502554 TCTGGATAGCAGAAAGTGGGGGG + Intronic
1084956870 11:72696317-72696339 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1086042113 11:82492142-82492164 GCTGTACAGCAGGAAGTGAGTGG + Intergenic
1086462497 11:87019532-87019554 GCTGCACAGCAGGAAGTGAGCGG - Intergenic
1086506276 11:87507900-87507922 GCTGCAAAGCTCGAAGTGGGTGG - Intergenic
1086801883 11:91185877-91185899 GCTGTACAGCAGGAGGTGTGCGG - Intergenic
1087060557 11:93972976-93972998 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1087454880 11:98372353-98372375 GCTGCACAGCAGAAGGTGAGGGG - Intergenic
1087456549 11:98394312-98394334 GCAGAAAAGCAGAAAGTTGGGGG - Intergenic
1087576268 11:99993669-99993691 GCTGCACAGCAGGAAGTGAGAGG - Intronic
1088266512 11:107992723-107992745 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1088970464 11:114770356-114770378 GATGCAATGCAGTATGTGTGTGG + Intergenic
1089081004 11:115776141-115776163 CCAACGAAGCAGAAAGTGTGTGG - Intergenic
1089095143 11:115913819-115913841 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1089215428 11:116831944-116831966 GCTGCACAGCACGAAGTGAGTGG - Intronic
1089329618 11:117680420-117680442 GCCACAGAGCAGAAAGTGTAGGG + Intronic
1089357982 11:117867968-117867990 GCTGCACATCAGAATGAGTGGGG - Intronic
1089833463 11:121349369-121349391 GCTGCACAGCAGGAAGTGAGCGG + Intergenic
1090194848 11:124805952-124805974 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1090892066 11:130932515-130932537 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1090929583 11:131283556-131283578 GCTGGAAAGGACACAGTGTGGGG + Intergenic
1090940952 11:131387964-131387986 TCTCCAAATCAGAAAGTATGGGG + Intronic
1091920635 12:4302069-4302091 GCTCCCAAGCAGAAACTGTACGG - Exonic
1092048510 12:5450736-5450758 GGTGCAATGTAGAAAATGTGTGG - Intronic
1092496959 12:9005932-9005954 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1092766091 12:11854328-11854350 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1092776189 12:11946824-11946846 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1092781114 12:11988327-11988349 GCCGCACAGCAGGAGGTGTGAGG - Intergenic
1092833880 12:12470022-12470044 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1093065890 12:14657552-14657574 GCTGCACAGCAGGAGGTGAGAGG + Intronic
1093832270 12:23776826-23776848 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1094066190 12:26363061-26363083 GCTGCATAGCAGGAAGTGAGTGG + Intronic
1094242771 12:28247995-28248017 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1095656211 12:44672247-44672269 GCCGCACAGCAGGAAGTGAGTGG + Intronic
1095695820 12:45142984-45143006 GCCGCACAGCAGGAGGTGTGTGG - Intergenic
1095697718 12:45159423-45159445 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1095757345 12:45783719-45783741 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1095811342 12:46375372-46375394 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1095862088 12:46928733-46928755 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1096238254 12:49944120-49944142 GCTGCAACACAGCAGGTGTGGGG + Intergenic
1096476169 12:51910623-51910645 GCTGCAAAGGAGAGGGTTTGAGG - Intronic
1097780632 12:63699946-63699968 GTTGCAAAGGAGAATGTGAGGGG - Intergenic
1098972907 12:76874683-76874705 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1099467948 12:83010049-83010071 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1099972373 12:89513722-89513744 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1100449782 12:94694850-94694872 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
1100735567 12:97525793-97525815 GCTGCACAGCAGGAAGTGTGTGG + Intergenic
1100993709 12:100279360-100279382 GCTGCAGAGCAGGAGGTGAGCGG - Intronic
1101152023 12:101891794-101891816 ACTGCACTGCAGAAACTGTGTGG + Intronic
1101262436 12:103046573-103046595 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1101734955 12:107456302-107456324 GCCGCATAGCAGGAAGTGAGTGG + Intronic
1101852055 12:108411258-108411280 GCTGTAATGCAGTAACTGTGTGG - Intergenic
1101861088 12:108483052-108483074 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1102114990 12:110396138-110396160 GCTGCACAGCAGGAGGTGGGTGG - Intronic
1102988561 12:117298391-117298413 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1103626306 12:122222864-122222886 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1103955802 12:124576201-124576223 GCTGAGAAGGAGAAAATGTGGGG - Intergenic
1104387192 12:128361243-128361265 GCTACAAAGCAGAGAGATTGTGG + Intronic
1104418512 12:128615697-128615719 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1104617869 12:130285473-130285495 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1104708704 12:130969335-130969357 GCTGCACAGCAGGAAGTGAGTGG + Intronic
1104949306 12:132431877-132431899 GCTGCAGGTCACAAAGTGTGGGG + Intergenic
1105328385 13:19391151-19391173 GCTGCACAACAGAAGGTGGGGGG + Intergenic
1105863480 13:24438374-24438396 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1106122021 13:26867994-26868016 GCAGCCAAGCAGAAAGAGTGTGG + Intergenic
1106513755 13:30434483-30434505 ACAGCAAAGCAGAAAAGGTGAGG + Intergenic
1106658319 13:31771287-31771309 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1106726421 13:32490853-32490875 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1106939836 13:34765979-34766001 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1107441731 13:40433779-40433801 GCCGCACAGCAGGAAGTGAGCGG + Intergenic
1107749563 13:43550163-43550185 GCTGCACAGCAGGAGGTGAGAGG - Intronic
1108992932 13:56686172-56686194 GCTCCAAAGCTGAATTTGTGAGG + Intergenic
1109182631 13:59231876-59231898 GCTGCAAGGCAGGAGGTGAGCGG - Intergenic
1110199531 13:72832593-72832615 CCTACAAGGCAGAAAGAGTGGGG - Intronic
1110630224 13:77698305-77698327 GCTGCAAAGCAGGGAGGGCGCGG - Intronic
1110745114 13:79043435-79043457 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1110778826 13:79441148-79441170 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1111320986 13:86628524-86628546 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1112022490 13:95383779-95383801 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1112508757 13:99990792-99990814 GCTGCCAGGCAGAGAGTGTGTGG + Intergenic
1112696847 13:101959242-101959264 GCTGCACAGCAGGAAGTGAGTGG - Intronic
1112865522 13:103891826-103891848 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1112902706 13:104378351-104378373 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
1113122740 13:106941978-106942000 CCTGCATAGCAGGAAGTGAGCGG - Intergenic
1113783590 13:112990096-112990118 GCTGCACAGCAGGAAGTGAGCGG - Intronic
1113910807 13:113840343-113840365 GCAGCTAAGCAGAAAGAGGGGGG - Intronic
1114373284 14:22113620-22113642 GCCGCAGAGCAGGAAGTGAGCGG - Intergenic
1114567024 14:23640098-23640120 AAAACAAAGCAGAAAGTGTGGGG - Intronic
1114598090 14:23931369-23931391 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1115308573 14:31957058-31957080 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1115321302 14:32082118-32082140 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1116082137 14:40187546-40187568 GCTGCAAAGCAGAGAGAATATGG + Intergenic
1116264299 14:42666879-42666901 GCTGCCAAGCAGGAGGTGAGTGG + Intergenic
1116790500 14:49335138-49335160 GCTGGGAAGCAGGAATTGTGAGG - Intergenic
1116966065 14:51016282-51016304 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1117157830 14:52958251-52958273 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1118336936 14:64861511-64861533 GCTGGAAAGCATCAAGTGGGTGG - Intronic
1118891448 14:69912989-69913011 GCTTCAAATTAGAAAGTGGGAGG + Intronic
1119121598 14:72084329-72084351 GCTGCATAGCAGGAGGTGGGCGG - Intronic
1120165453 14:81194107-81194129 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1120558224 14:85956719-85956741 GCTGCACAGCAGGTGGTGTGTGG + Intergenic
1120868649 14:89317775-89317797 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1121947926 14:98140981-98141003 GCAAAAAAGCAGAAAGTATGGGG - Intergenic
1122027638 14:98889068-98889090 TCTGCAAAGAATAAAGTGAGGGG - Intergenic
1122412793 14:101534523-101534545 CCTGCAATGCAGAAAGTAGGGGG + Intergenic
1123679159 15:22745247-22745269 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124331378 15:28819697-28819719 GCTGCACAGCAGGAGGTGGGTGG + Intergenic
1124842539 15:33257102-33257124 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1124917829 15:33994117-33994139 GCTGCATAGCAGGAGGTGAGTGG + Intronic
1125249046 15:37678318-37678340 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1125932636 15:43611385-43611407 GCAGCAAGGCAGTAAGTATGAGG + Intronic
1125945734 15:43710847-43710869 GCAGCAAGGCAGTAAGTATGAGG + Intergenic
1126390405 15:48143568-48143590 GTTGCAAAGCAGAATTAGTGGGG - Intronic
1126608639 15:50506256-50506278 GCTGCACAGCAGGAAGCGAGCGG + Exonic
1126693978 15:51310456-51310478 TCTGCAAGACAAAAAGTGTGGGG + Intronic
1127448537 15:59091972-59091994 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1127477344 15:59347133-59347155 GCTGCACAGCAGCAGGTGAGTGG + Intronic
1128014876 15:64334797-64334819 GCTGCATAGCAGGAAGTGAGTGG - Intronic
1128662737 15:69514011-69514033 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1128925938 15:71655986-71656008 GCTGCAAACCAGAAAACCTGGGG - Intronic
1129031819 15:72624254-72624276 GCTGCGCAGCAGGAAGTGAGTGG + Intergenic
1129218124 15:74113215-74113237 GCTGCGCAGCAGGAAGTGAGTGG - Intronic
1129279236 15:74470902-74470924 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1129735241 15:77957257-77957279 GCTGCGCAGCAGGAAGTGAGTGG - Intergenic
1129834398 15:78692894-78692916 GCTGCAGAGAAGAAAGAGGGAGG + Intronic
1130475207 15:84259897-84259919 ACTGCAAAACAAAAAGTTTGAGG - Intergenic
1130482623 15:84373950-84373972 ACTGCAAAACAAAAAGTTTGAGG - Intergenic
1132033351 15:98457510-98457532 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1132076494 15:98825445-98825467 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1132087338 15:98919060-98919082 CCTAGAAAGCAGAAAGTTTGAGG + Intronic
1132306389 15:100817207-100817229 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1132344104 15:101097377-101097399 GCTGCACAGCGGAAGGTGAGAGG - Intergenic
1132446821 15:101930474-101930496 GCTGCTGAGCAGAAGGTGTTTGG + Intergenic
1133620974 16:7526003-7526025 GCTGCACAGCAAAAGGTGAGTGG + Intronic
1133650341 16:7806784-7806806 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1134459836 16:14421481-14421503 GCCGCACAGCAGGAGGTGTGCGG + Intergenic
1135347321 16:21700249-21700271 TCTTCAAAGCAGAAAGTTTGTGG + Intronic
1135357361 16:21780631-21780653 GCGGAAAAGCAGAAAATGTCAGG - Intergenic
1135455865 16:22596747-22596769 GCGGAAAAGCAGAAAATGTCAGG - Intergenic
1135470940 16:22730059-22730081 GCTGCATAGCAGGAGGTGAGCGG + Intergenic
1135598045 16:23758174-23758196 GCTGCACAGCACAAGGTGAGCGG - Exonic
1137693508 16:50446102-50446124 GCTGCAAAACAGACAGCCTGGGG - Intergenic
1138513135 16:57520193-57520215 GCTGGAGAGCAGGAAGTGAGAGG - Intronic
1138560721 16:57799489-57799511 GCTGCAAACATGAATGTGTGTGG - Intronic
1138620605 16:58208044-58208066 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1138925647 16:61587647-61587669 ACTGCAAAGCAGAAAGCTAGAGG - Intergenic
1139112988 16:63915337-63915359 TCTGGAAAGCAGAGAATGTGAGG - Intergenic
1139392550 16:66614175-66614197 GCTGCACAGCAGGAGGTGGGTGG - Intergenic
1139488589 16:67273472-67273494 GATGCAAATCAGATAGTGTGGGG + Intergenic
1140013661 16:71161348-71161370 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1140298632 16:73734187-73734209 GCTGCACAGCAGGAAGTGGGAGG - Intergenic
1140418655 16:74797523-74797545 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1140534563 16:75697751-75697773 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1140606576 16:76546295-76546317 GCTGCACAGCAGTAGGTGAGTGG + Intronic
1140976909 16:80068595-80068617 TAGGCAGAGCAGAAAGTGTGCGG + Intergenic
1141067094 16:80922892-80922914 GCTGCAAACCAGAAGATGTGGGG - Intergenic
1142399333 16:89851119-89851141 TCTGGTAAGAAGAAAGTGTGAGG - Intronic
1143209584 17:5175204-5175226 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1143212447 17:5198634-5198656 GCTGCACAGCAGGAAGTAAGTGG + Intergenic
1143499312 17:7329636-7329658 GTCGCAAAGCAGAAAGTGTTTGG - Intergenic
1144026665 17:11282805-11282827 GCTGCCAAGCAGCAAGTGGGAGG + Intronic
1144221747 17:13106117-13106139 GCTTCAAAGCAGAAAGATGGGGG + Intergenic
1144518663 17:15939423-15939445 GCTGCACAGCAGACATTCTGGGG + Intergenic
1144617823 17:16792517-16792539 GCTGCACAGCAGCAGGTGAGCGG - Intronic
1144619063 17:16804664-16804686 GCTGCACAGCAGCAGGTGAGCGG + Intergenic
1144665669 17:17100520-17100542 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1144893637 17:18511031-18511053 GCTGCACAGCAGCAGGTGAGCGG - Intergenic
1144894881 17:18523165-18523187 GCTGCACAGCAGCAGGTGAGCGG + Intergenic
1145137342 17:20421069-20421091 GCTGCACAGCAGCAGGTGAGTGG - Intergenic
1145138586 17:20433243-20433265 GCTGCACAGCAGCAGGTGAGTGG + Intergenic
1146182325 17:30706249-30706271 GCTGCGAAGCCGAAGGTCTGAGG + Intergenic
1149076528 17:52602056-52602078 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
1149266920 17:54937032-54937054 TCTACAAAGGAGAAAGTATGGGG + Intronic
1149290670 17:55215106-55215128 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1149369187 17:55976358-55976380 GCTGAAAAACAGAAAGGCTGGGG + Intergenic
1149794791 17:59509165-59509187 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1149870559 17:60177000-60177022 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1150031973 17:61748102-61748124 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1150517103 17:65825400-65825422 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1150981848 17:70151305-70151327 GCCACAAAGCAGAATGTGAGTGG + Intergenic
1151200290 17:72462949-72462971 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1151288652 17:73132404-73132426 GCTGCAAGGCAGAAAGGCAGGGG + Intergenic
1151331627 17:73413074-73413096 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1151881096 17:76895011-76895033 GCTGCACAGCAGGAAGTGGGCGG + Intronic
1152296157 17:79468015-79468037 GCTGCAAAGTGGGAAGTGAGAGG - Intronic
1152551243 17:81031412-81031434 GCTGCCAGGCAGAAGGTGGGAGG + Intergenic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1153529104 18:6025863-6025885 GCTGCGCAGCAGGAAGTGAGCGG - Intronic
1153550949 18:6261541-6261563 GCTGGAAGGCAGTAAGTGGGAGG - Intronic
1153745707 18:8177586-8177608 GCAGCAAATCAGTAAGTGTTGGG + Intronic
1153953834 18:10079177-10079199 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1153955053 18:10089010-10089032 GCTGCACAGATGAGAGTGTGGGG + Intergenic
1154368840 18:13738966-13738988 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1155347565 18:24873853-24873875 GCCGCAGAGAAGAAAGAGTGTGG - Intergenic
1155367009 18:25058759-25058781 GCTACACAGCAGGAAGTGAGTGG - Intergenic
1155634697 18:27939162-27939184 GCTGCAAGGAAGAAAACGTGGGG - Intergenic
1155926331 18:31659466-31659488 GCTGCTAAGCAGAGGGTGTTGGG + Intronic
1156009644 18:32481665-32481687 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1157594363 18:48854930-48854952 GATGCAAAGCAGCACTTGTGAGG - Intronic
1157691071 18:49682340-49682362 GCTGCAAAGCAGGGAGCCTGAGG + Intergenic
1157744391 18:50122035-50122057 GCTGCAAAGCAGCAGCTTTGGGG - Intronic
1157870146 18:51222626-51222648 GCTGCACAGCAGGAAGTGACTGG + Intergenic
1157920692 18:51710177-51710199 TCTGCAAAGAAGTGAGTGTGAGG - Intergenic
1158285295 18:55874113-55874135 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
1158389390 18:57032490-57032512 GCTGCACAGCAGGAGGTGAGTGG + Exonic
1158909529 18:62046354-62046376 GCTGCAAAGCAGGAGGTGAGTGG + Intronic
1159016860 18:63108119-63108141 GCTCCAAAGGAGAAAGGATGAGG - Intergenic
1159224135 18:65509844-65509866 GCTGCAAAGCAGAGGGTATTGGG - Intergenic
1160087985 18:75797182-75797204 TGTGCAAACCAGTAAGTGTGTGG + Intergenic
1160268854 18:77365669-77365691 TCTGCAAAGTAGAATGTGTGAGG - Intergenic
1160549951 18:79688047-79688069 GCTGTAAAGCACAACGTCTGAGG - Intronic
1160618203 18:80150079-80150101 TTTGCTAAGCAGAAAGTGTTGGG + Intronic
1160638398 19:101743-101765 GCTGCTGAGCAGAAGGTGTTTGG - Intergenic
1161320253 19:3637739-3637761 ACTGCCAAGCAGAAGGTGGGGGG + Intronic
1162123117 19:8484599-8484621 GCTGCACAGCACACAGTGAGCGG - Intronic
1163054122 19:14705680-14705702 GCTGCAGAGCAGGAGGTGAGCGG + Intronic
1163193811 19:15699715-15699737 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1163846185 19:19639470-19639492 GCTTCCAAGCAGAAAGGATGGGG - Intronic
1164494571 19:28748162-28748184 GCTGCAAAGCAGGAGGTGAGTGG + Intergenic
1165002495 19:32776456-32776478 CCTTTAAACCAGAAAGTGTGGGG - Intronic
1165402578 19:35611307-35611329 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1166594005 19:44028252-44028274 CCAGCTAAGCAGAAAGTGGGAGG - Intronic
1166596045 19:44051332-44051354 GCGGCACAGCAGGAAGTGAGCGG - Intergenic
1167768155 19:51497890-51497912 GCTGCCAAGCAGTGAGTGCGGGG - Intronic
1202666043 1_KI270708v1_random:120650-120672 GCTGCACATCAGGAAGTGAGTGG + Intergenic
925439494 2:3872145-3872167 GCTGCACAGCAGAAGGTGAACGG - Intergenic
925942205 2:8831395-8831417 TCTGGAAAGAACAAAGTGTGGGG - Intronic
926222829 2:10947549-10947571 GCTGCAGAGGAGGTAGTGTGGGG - Intergenic
927244235 2:20943988-20944010 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
927257316 2:21050792-21050814 TCTCCAAAGAAGAAAGTGGGTGG + Intergenic
927465354 2:23332450-23332472 GTGGGAAAGAAGAAAGTGTGAGG - Intergenic
927774754 2:25893945-25893967 ACTGCAAAGCAGTAGGTGTAGGG + Intergenic
927882462 2:26698290-26698312 GCTGCCCTGCAGAAATTGTGGGG - Intronic
928040555 2:27872115-27872137 GCTGCAAAGCAGGAGGTGAGTGG - Intronic
928930493 2:36619092-36619114 GCTGCACAGCAGGAGGTGAGCGG + Intronic
929641000 2:43579825-43579847 GCAGAAAAGCAGAAAATGTGTGG + Intronic
929675128 2:43919029-43919051 GCTGCACAGCAGAATGTGTACGG + Intronic
929837827 2:45424220-45424242 GCTGCCTAGCACAAAGTATGAGG - Intronic
930157848 2:48123975-48123997 GCTGCACAACAGGAAGTGAGTGG - Intergenic
930682470 2:54271641-54271663 GCTGCCAAGCAGAAGGACTGGGG - Intronic
930818222 2:55620308-55620330 GCGGCACAGCAGAAGGTGAGTGG + Intergenic
931367624 2:61632701-61632723 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
931495698 2:62804746-62804768 GCTGCACAGCAGGAGGTGAGTGG + Intronic
932959956 2:76402041-76402063 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
933072099 2:77871691-77871713 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
933596693 2:84289921-84289943 GCTGCAGAACAGAAGGTGGGAGG + Intergenic
934569895 2:95362743-95362765 GCTGCACAGCAGGAGGTGGGCGG - Intronic
934625798 2:95849892-95849914 GCTGCACAGCAGGAGGTGAGTGG - Intronic
934807774 2:97251426-97251448 GCTGCACAGCAGGAGGTGAGTGG + Intronic
934829736 2:97505761-97505783 GCTGCACAGCAGGAGGTGAGTGG - Exonic
935048746 2:99505738-99505760 GCTGGAAATCAGAAGGTGCGTGG + Intergenic
935084372 2:99830409-99830431 TCTGCAAAGCAAAAATTGTAAGG + Intronic
935124215 2:100208677-100208699 GGTGCACAGCAGAAAGTGGGGGG + Intergenic
936495861 2:113020368-113020390 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
938391792 2:130912409-130912431 GTTGCAAAGCAGAAGGCGTTCGG - Intronic
938904835 2:135827759-135827781 GCTGCACAGCAGGAGGTGAGTGG - Intronic
939937057 2:148305547-148305569 ACTGCAAACCAGGAAATGTGTGG - Intronic
940092728 2:149938944-149938966 GCTGCAGAGCAGAAGGAGGGAGG - Intergenic
941230318 2:162903885-162903907 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
941823422 2:169865647-169865669 GCTGGAAAGCAGAAAGAGAAAGG - Intronic
941841650 2:170091613-170091635 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
942230273 2:173854556-173854578 GCTGAGAACCAGAAAGTGAGGGG - Intergenic
942254712 2:174085294-174085316 GCTGCACAGCAGGAGGTGAGTGG + Intronic
942840038 2:180349180-180349202 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
943971415 2:194412286-194412308 ACAGCAAAGAAGAAAGTGGGAGG - Intergenic
944068730 2:195646685-195646707 GCTGCACAGCAGGAGGTGAGCGG + Intronic
944338776 2:198569945-198569967 GCTGCCAAGCAGGAGGTGAGCGG - Intronic
944626548 2:201575453-201575475 GCTGCACAGCAGGAAATGAGTGG + Intronic
945324604 2:208467991-208468013 GCTGCATAGGAGACGGTGTGAGG - Intronic
945568611 2:211435539-211435561 GCTGCACAGCAGGAGGTGAGTGG + Intronic
946106709 2:217376653-217376675 GATGCAAAGCAGAGAGTTTTGGG + Intronic
946473662 2:219986901-219986923 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
946724571 2:222649494-222649516 GCTTCAAAGCCAAAAGTGTCAGG - Intronic
946867721 2:224057709-224057731 GATGCACAGCAGGAAGTGAGTGG - Intergenic
946894331 2:224307933-224307955 GCTGCATAGCAGGAGGTGTGCGG + Intergenic
947000857 2:225454571-225454593 GCTGCACAGCAGGAGGTGAGTGG + Intronic
947287204 2:228530067-228530089 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
947378987 2:229526708-229526730 GCCGCATAGCAGAAAGTCAGTGG - Intronic
947561724 2:231160003-231160025 GCTGCAGAGCAGGAGGTGAGCGG - Intronic
948108789 2:235437540-235437562 GCTGCACAGTAGAAGGTGAGTGG - Intergenic
948539826 2:238682711-238682733 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
948684451 2:239661418-239661440 ACTGTCAAGCAGAAAGTGAGAGG - Intergenic
948690252 2:239697684-239697706 GCTGCACAGCAGAAGGCGAGAGG - Intergenic
948757639 2:240168710-240168732 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
948926373 2:241101424-241101446 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1168805532 20:670314-670336 GCGGCAGAGCAGAAAGTAGGAGG - Intronic
1168987751 20:2064780-2064802 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1169931712 20:10839985-10840007 GGTGCAAAGAGGAAAGAGTGTGG + Intergenic
1170018828 20:11813262-11813284 GCTGCAAAGCAGAAGCTGAGTGG - Intergenic
1170768930 20:19315376-19315398 GGTGCAAAGAAGCAAGTGTATGG + Intronic
1170909300 20:20548694-20548716 GCTGCAGTTTAGAAAGTGTGTGG + Intronic
1170940102 20:20841659-20841681 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
1171053748 20:21885826-21885848 GCTGGAAGGTAGAAAGTGTTAGG + Intergenic
1171073374 20:22097831-22097853 GCTGCAGAGCAGGTTGTGTGAGG + Intergenic
1171419880 20:25010919-25010941 GCTGCAAAACAGAGAGAGTGGGG + Intronic
1172626682 20:36351321-36351343 GCTGCACAGCAGGAAGTGAGTGG + Intronic
1173564024 20:44026633-44026655 GCTGGAGAGCAGGAAATGTGTGG + Intronic
1174044442 20:47723509-47723531 GCTGCATAGCAGGAGGTGAGTGG + Intronic
1174134907 20:48372909-48372931 GCAGCAAAGCAGTCAGGGTGAGG + Intergenic
1174142867 20:48428847-48428869 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1174744948 20:53052329-53052351 GCTCCACAGCAGGAAGTGAGTGG + Intronic
1174973354 20:55303653-55303675 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1175011219 20:55739094-55739116 CCTGCAAAGCAGCAAGTTTTAGG + Intergenic
1175349034 20:58305258-58305280 TCTTGAAAGCGGAAAGTGTGTGG - Intergenic
1175495171 20:59409298-59409320 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1175573227 20:60039860-60039882 GCTGCAAAGCCCATGGTGTGAGG + Intergenic
1175604030 20:60297882-60297904 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1176007568 20:62874801-62874823 GCCCCAAAAGAGAAAGTGTGAGG + Intergenic
1178065064 21:28895530-28895552 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1178076536 21:29018035-29018057 TCTCCATAGCAGCAAGTGTGGGG - Intronic
1178437472 21:32572807-32572829 GCTGCACAGCAGGAAGTGAGCGG - Intergenic
1178595818 21:33951419-33951441 GGGGCAAAGCAGAAGGTGGGAGG + Intergenic
1179223352 21:39429655-39429677 GCTACACAGCAGAATGTGTCTGG - Intronic
1179251984 21:39678231-39678253 TCTGCAAACCAGGAAGAGTGGGG + Intergenic
1180100773 21:45583979-45584001 CCTGCACAGCAGCAAGTGAGTGG - Intergenic
1180149014 21:45938256-45938278 GCTCCAGCGCAGAAAGTGTTAGG + Intronic
1180721282 22:17910637-17910659 GCTGCAAAGCAGGAAAAGTGAGG - Intronic
1181579024 22:23816684-23816706 GCTTCAAAGAAGAAGGGGTGAGG + Intronic
1182569349 22:31224911-31224933 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1183618527 22:38959451-38959473 GGTGCAAGGGAGGAAGTGTGGGG + Intronic
1183731863 22:39622699-39622721 GATGCAGAGCAGCAAGTGGGTGG + Intronic
1184058689 22:42068746-42068768 CTTGCAAAGCAGTAAGTGGGAGG + Intronic
1184762850 22:46554727-46554749 AATGCACAGCAGAAAGAGTGAGG - Intergenic
949316713 3:2764502-2764524 GCAGCAGAGCAGAAAGTGGTGGG + Intronic
949962299 3:9322492-9322514 GCTGCACAGCAGGAGGTGAGTGG + Intronic
950051311 3:9992016-9992038 GCTGCACAGCAGGAGGTGAGGGG - Intronic
950257288 3:11515947-11515969 GCTGAAGATCAGAAAGTTTGTGG + Intronic
950300121 3:11869594-11869616 GCTGCACAGCAGGAGGTGAGGGG - Intergenic
950826118 3:15823305-15823327 GCTGCACAGCAGGAGGTGAGCGG - Intronic
950969234 3:17170038-17170060 GCTGCACAGCAGGAGGTGAGGGG - Intronic
951224809 3:20108727-20108749 GCTGCACAGCAGGAAGTGAGTGG + Intronic
951515736 3:23557192-23557214 TTTGCAAAGCAAAAATTGTGAGG + Intronic
952435939 3:33272480-33272502 GCTGCATAGCAGGAGGTGAGCGG + Intergenic
953300319 3:41767968-41767990 GCTGCACAGCAGAAGGTGAGCGG + Intronic
953309904 3:41866588-41866610 GCTGCACAGCAGGAGGTGAGTGG - Intronic
953706974 3:45238495-45238517 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
954820883 3:53326511-53326533 GCTGCACAGCAGAAGGTGAGTGG + Intronic
954941643 3:54378410-54378432 GCTGCACAGCAGGAGGTGAGTGG - Intronic
955022242 3:55132626-55132648 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
955416582 3:58697555-58697577 GCTGATAAGGAGAAAGTTTGAGG - Intergenic
955572945 3:60327380-60327402 GCTGCACAGCAGAGATTGTATGG - Intronic
956296847 3:67724227-67724249 GCTGAAGAGCAGAATTTGTGGGG + Intergenic
956390595 3:68769085-68769107 GCTGCACAGCAGAAGGTAAGTGG + Intronic
956393500 3:68799811-68799833 GCTGCACAGCAGGAAGTAAGTGG + Intronic
957531246 3:81443141-81443163 GCTGCATAGGGGAAATTGTGAGG + Intergenic
958411519 3:93822459-93822481 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
959351781 3:105274483-105274505 CCTGGAAACCAGAGAGTGTGAGG - Intergenic
959827497 3:110816001-110816023 CCTGCAAAACAGAAAATGTAGGG + Intergenic
959850685 3:111083102-111083124 ACCGCACAGCAGAAAGTGAGTGG - Intronic
960024910 3:112998065-112998087 AGTGAGAAGCAGAAAGTGTGTGG - Intronic
960285598 3:115824940-115824962 GCTGGAAAATAGAAAGTGAGGGG - Intronic
960537562 3:118830184-118830206 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
961020149 3:123498446-123498468 GCTGCACAGCAGGAGGTGAGTGG + Intronic
961209671 3:125116114-125116136 GCAGGAAAGCAGAAAAGGTGTGG + Intronic
961234273 3:125350762-125350784 GCTGCACAGCAGGAAGTGAGTGG - Intronic
962285450 3:134082234-134082256 GCTGCACAGCAGGAGGTGAGTGG + Intronic
962574644 3:136745643-136745665 GCTGCACAGCAGGAGGTGAGAGG - Intronic
963155516 3:142091860-142091882 GCTGCATAGCAGAAGGTGAGCGG - Intronic
963308060 3:143676196-143676218 GCTGCACAGCAGGAGGTGAGTGG - Intronic
963989415 3:151635776-151635798 GAAGGAAAGCAGATAGTGTGGGG + Intergenic
964051204 3:152395928-152395950 GCTGCACAGCAGGAGGTGAGTGG + Intronic
964667125 3:159187026-159187048 TCTTCAAAGCAGAAACTTTGAGG - Intronic
966217915 3:177521448-177521470 GCTGCACAGCACAAGGTGAGCGG - Intergenic
966334931 3:178857396-178857418 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
966556801 3:181271508-181271530 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
966762390 3:183429114-183429136 GCTGCCAGTCAGAAAGTGTCTGG - Intergenic
966812100 3:183856023-183856045 GCTGCAGAGCAGGAGGTGAGCGG - Intronic
966870813 3:184289521-184289543 GCAGCCAAGGAGAAAGTGAGCGG + Exonic
967208686 3:187147775-187147797 GCTGCACAGCAGGAGGTGAGCGG - Intronic
968789513 4:2649824-2649846 GCTGCACAGCAGGAGGTGAGTGG + Intronic
968937624 4:3620700-3620722 TCTGCAAAGCAGAAAAGGAGGGG + Intergenic
969093777 4:4717313-4717335 GCAGCACAGCAGACAGAGTGTGG + Intergenic
969144256 4:5107020-5107042 GCTGCATAGCAGGAGGTGAGAGG + Intronic
970018198 4:11536273-11536295 GCTGCTTAGCAGAAAGCGAGAGG - Intergenic
970430481 4:15984543-15984565 GCTCCACAGCAGGAAGTGAGGGG + Intronic
971032938 4:22660572-22660594 ACTGCACAGCAGAAGGTGAGTGG + Intergenic
971483732 4:27138693-27138715 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
972250312 4:37292911-37292933 GCTGCACAGCAGGAGGTGAGCGG - Intronic
972292689 4:37704609-37704631 GGTGGAAAGCAGAAGGTGTAGGG - Intergenic
972660483 4:41111218-41111240 GCTGCACAGCAGGAGGTGAGTGG - Intronic
973133139 4:46673088-46673110 GCGGCACAGCAGGAAGTGAGTGG - Intergenic
974191379 4:58508084-58508106 GTTGCAAAATAGAAAGTGTCTGG + Intergenic
974488511 4:62534208-62534230 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
975597622 4:76065161-76065183 TTTGCAAAGCAAAAATTGTGAGG + Intronic
975932094 4:79537492-79537514 GCTGCACAGCAGGAAGTGAGTGG + Intergenic
976407822 4:84679522-84679544 GCAGCACAGCAGGGAGTGTGCGG - Intronic
976623454 4:87152864-87152886 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
976932515 4:90586087-90586109 GCTGCACAGCAGGAGGTGAGTGG + Intronic
977235150 4:94499704-94499726 GCTGCACAGCAGGAGGTGAGTGG + Intronic
977431254 4:96933140-96933162 GCTGCACAGAAGAGATTGTGTGG - Intergenic
977486265 4:97650202-97650224 GCTGCATAGCAGGAGGTATGTGG - Intronic
977876706 4:102158238-102158260 GTTGCACAGCAGGAAGTGAGTGG - Intergenic
978009282 4:103659165-103659187 GCTGCACAGCAGGAAGTGAGTGG - Intronic
979114966 4:116812065-116812087 GCTGCACAGCAAGAAGTGAGTGG + Intergenic
979542260 4:121898309-121898331 GCTGCACAGCAGGAAGTGACAGG + Intronic
979790986 4:124780907-124780929 GCTGCACAGCAGGAGGTGAGAGG + Intergenic
980021134 4:127711573-127711595 GCTGCACAGCAGGAGGTGAGTGG + Intronic
980501146 4:133655985-133656007 GCGGCAAAGCAGGAGGTGAGCGG - Intergenic
981088648 4:140709914-140709936 GCTGCACAGCAGGAGGTGAGTGG - Intronic
981357922 4:143812601-143812623 GCTACACAGCAGGAAGTGAGTGG - Intergenic
981369168 4:143938728-143938750 GCTGCACAGCAGGAAGTGAGTGG - Intergenic
981378911 4:144048662-144048684 GCTACACAGCAGGAAGTGAGTGG - Intergenic
981944946 4:150330694-150330716 GCTGCATAGCAGGAGGTGAGTGG - Intronic
982809061 4:159803598-159803620 GCTGCACAGCAGAAGGGGTGTGG - Intergenic
982857746 4:160406709-160406731 CCTGCAAAGGAGAAAGTGTAGGG + Intergenic
983040841 4:162923845-162923867 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
983295050 4:165856757-165856779 GCTGCACAGCAGGAGGTGAGGGG - Intergenic
984182875 4:176506972-176506994 GCTGCAAAGGAGAGAGAGAGAGG - Intergenic
985143826 4:186872245-186872267 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
985485668 5:146790-146812 GATGCAAGGGGGAAAGTGTGGGG - Intronic
986822493 5:11482850-11482872 GGTGCAAAGCAGGGAGTGAGGGG + Intronic
986935717 5:12883555-12883577 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
987131319 5:14862632-14862654 GCAGCAGAGCAGTAAGTCTGTGG - Intronic
987489132 5:18554468-18554490 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
987668827 5:20982158-20982180 GCTGCAGAAAAAAAAGTGTGAGG - Intergenic
988120651 5:26956654-26956676 GGTGGAAAGCAGAAAGCCTGTGG - Intronic
988553321 5:32216243-32216265 GCTGCACAGCAGGAGGTGAGGGG + Intergenic
988805529 5:34736925-34736947 GCTGCACAGCAGGAGGTGAGTGG + Intronic
989705054 5:44319896-44319918 GCTGCACAGCAGGAAGTGGCCGG + Intronic
989762029 5:45027222-45027244 GCTCCAAAGCAGAAAGAGTTTGG + Intergenic
990231006 5:53712789-53712811 GGTCCAAAGCACAGAGTGTGTGG - Intergenic
990323547 5:54652353-54652375 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
991095051 5:62731174-62731196 GCCACAAAGCAGGAAGTGAGTGG - Intergenic
991672305 5:69060586-69060608 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
992096391 5:73366783-73366805 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
992518389 5:77521363-77521385 GCTGCACAGCAGGAGGTGAGTGG - Intronic
992561318 5:77955885-77955907 GGTGCACAGCAGAAATTGAGAGG - Intergenic
992613526 5:78528294-78528316 GCTGCACAGCAGGAGGTGAGTGG + Intronic
992716963 5:79520595-79520617 GCAGCACAGCAGGAAGTGAGTGG - Intergenic
993037304 5:82771810-82771832 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
993426041 5:87765219-87765241 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
993847696 5:92966149-92966171 GCTGCAGAGCAGGAGGTGAGTGG + Intergenic
994329477 5:98488825-98488847 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
994985180 5:106924047-106924069 GCTGCATAGCAGGAGGTGAGTGG + Intergenic
995173801 5:109149876-109149898 GCTGCCCAGCAGGAAGTGAGCGG + Intronic
995339710 5:111044378-111044400 GCTGCACAGCAGGAGGTGTGTGG - Intergenic
995390420 5:111634537-111634559 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
995548038 5:113252267-113252289 GCCGCAAAGCAGGAGGTGAGTGG + Intronic
995881059 5:116845257-116845279 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
996429752 5:123360425-123360447 CCTCTAAAGCAGAAAGTTTGTGG + Intronic
996698633 5:126425847-126425869 GCTGGAAGGTAGAAAGGGTGGGG + Intronic
996918913 5:128744328-128744350 GAAGAAAAGCAGAATGTGTGTGG + Intronic
997358420 5:133279204-133279226 GCTGCACAGCAGGAGGTGAGCGG + Intronic
997839927 5:137229930-137229952 GCTGCACAGCAGGAGGTGAGCGG - Intronic
997900612 5:137760550-137760572 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
998008137 5:138671199-138671221 GCTGCACAGCAGGAGGTGAGTGG - Intronic
999016866 5:148116348-148116370 GCTGGAAATTAGAAAGTGGGAGG - Exonic
999520805 5:152348984-152349006 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
999941259 5:156545683-156545705 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1001144661 5:169173286-169173308 GTTGGATAGCAGAAAGTGAGAGG + Intronic
1001225427 5:169940797-169940819 GCTGCACAGCAGGAAGTGAGTGG - Intronic
1001360495 5:171080132-171080154 GTTTTAAAGCATAAAGTGTGTGG - Intronic
1001582363 5:172807467-172807489 GAGGTAAAACAGAAAGTGTGCGG - Intergenic
1001756055 5:174170982-174171004 GCCGCAGAGCAGGAAGTGAGTGG - Intronic
1001894411 5:175365967-175365989 GCTGCACAGCAGAAAGTGAATGG + Intergenic
1002471075 5:179436450-179436472 GCTTTAAAGTAGAGAGTGTGGGG + Intergenic
1002765095 6:232623-232645 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1003304403 6:4913388-4913410 GTTAAAAAGCAAAAAGTGTGTGG + Intronic
1004034900 6:11914424-11914446 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1004157941 6:13187152-13187174 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1004202206 6:13559330-13559352 GCTTCAAAACTGAATGTGTGTGG + Intergenic
1004588989 6:17030709-17030731 CCTGCACACCAGAAAGGGTGGGG - Intergenic
1004632672 6:17436797-17436819 GCTGCAGAGCAGGAGGTGAGTGG + Intronic
1004775393 6:18838492-18838514 TCTGTAAAGCAGACAGTGTTAGG + Intergenic
1004831083 6:19477264-19477286 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
1004949739 6:20655484-20655506 GCTGCACAGCAGGAAGTGAGTGG + Intronic
1005582328 6:27247160-27247182 GAAGCAGAGCAGAAAGTGAGGGG + Intergenic
1005660533 6:27994285-27994307 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1006269180 6:32950803-32950825 GCTGCAAAGGACACAGGGTGAGG + Exonic
1007096689 6:39217664-39217686 GCGGCAAATCATAAAATGTGAGG - Intronic
1007141993 6:39585397-39585419 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1007948791 6:45850912-45850934 CCTGGAAAGCAGAAAGGCTGAGG + Intergenic
1008112582 6:47508835-47508857 GCTGATATGAAGAAAGTGTGAGG - Intronic
1008518629 6:52342259-52342281 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1008691250 6:53981659-53981681 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1008694161 6:54014628-54014650 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1008824971 6:55683037-55683059 GCTGCAGAGCAGGAGGTGAGCGG + Intergenic
1009517785 6:64641718-64641740 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1009922741 6:70082996-70083018 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1010250900 6:73706060-73706082 TCTTCAAAGAAGAAAGTATGAGG - Intronic
1010680688 6:78795344-78795366 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1010726137 6:79336079-79336101 TCGGCAAACCAGAAATTGTGAGG + Intergenic
1011940595 6:92837370-92837392 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1012281751 6:97336030-97336052 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1012371335 6:98511131-98511153 GCTGCACAGCAGGAAGTAAGTGG + Intergenic
1012395617 6:98793390-98793412 CCTGGAAAGCATAAAGTATGGGG - Intergenic
1012972588 6:105747709-105747731 GTTACAAAGCAGAAATTTTGTGG + Intergenic
1014151515 6:118061921-118061943 GCTGCATAGCAGGAGGTGAGCGG - Intronic
1014203599 6:118630776-118630798 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1015029202 6:128573902-128573924 TCTGAAAAGCAGAATGTGTCAGG - Intergenic
1015066799 6:129039863-129039885 GCTGCACAGCAGGAAGTGAGTGG - Intronic
1015084498 6:129272711-129272733 GCTGCCTAGCAGGAAGTGAGTGG + Intronic
1015232045 6:130925654-130925676 GCTGCAAAAGAGAAAGTGGTGGG - Intronic
1015635652 6:135271420-135271442 GCTGGAAGCCAGAAGGTGTGGGG + Intergenic
1015985657 6:138881849-138881871 GCTGCATAGCAGGAGGTGAGTGG - Intronic
1016203199 6:141438910-141438932 GCCACACAGCAGAAAGTGAGTGG + Intergenic
1016634270 6:146269580-146269602 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1017302470 6:152878693-152878715 GCAGAAAAAGAGAAAGTGTGTGG - Intergenic
1017784843 6:157747101-157747123 GCTGCATAGCAGGAGGTGAGCGG - Intronic
1018050072 6:160001124-160001146 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1018558181 6:165072033-165072055 GCAGCACAGCAGAAGGTGAGTGG + Intergenic
1018561434 6:165104312-165104334 GCTGGAATGCACAATGTGTGTGG + Intergenic
1018662308 6:166099492-166099514 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1018664720 6:166125197-166125219 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1018683599 6:166284597-166284619 GCTGCAAGCCAGGAAGTGAGAGG - Intergenic
1018796304 6:167187924-167187946 GCTGCACAGCAGGAGGTGAGCGG + Intronic
1018820011 6:167367135-167367157 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1018894349 6:168003056-168003078 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020145348 7:5638035-5638057 GCGGCAAAGGAGAGGGTGTGGGG - Intronic
1021284217 7:18759274-18759296 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1021709884 7:23405542-23405564 GCCGCACAGCAGAAGGTGAGAGG + Intronic
1021819236 7:24479929-24479951 GCTGGAAACCACAAACTGTGGGG - Intergenic
1022146486 7:27547134-27547156 GCTGGAAAGCAGCAAGTGATGGG - Intronic
1022546881 7:31198147-31198169 GCCGCACAGCAGGAAGTGAGTGG - Intergenic
1022939216 7:35215992-35216014 GTTGCAAAGGAGAATGTGAGGGG - Intronic
1022993300 7:35729347-35729369 ACTGAAAAGCAGAAAGTGATGGG + Intergenic
1023033674 7:36112153-36112175 GTTGCAGAGCAGAAAGATTGTGG + Intergenic
1023337217 7:39183041-39183063 GCTGCACAGCAGGAGGTGAGAGG + Intronic
1023640425 7:42251439-42251461 GCTGCACAGCAGGAGGTGAGCGG - Intergenic
1023921144 7:44631015-44631037 GTTGCATAGCAGGAAGTGAGCGG - Intronic
1024215581 7:47245683-47245705 CGTGCAAAGCAGAATGTGTGGGG + Intergenic
1024465703 7:49709724-49709746 GCTGCAGAGCATAAATGGTGTGG + Intergenic
1024975344 7:55109048-55109070 GCTGCAAGGGAGAAGGTGGGAGG + Intronic
1026209974 7:68295507-68295529 GCTGCACAGCAGGAAGTGAGTGG - Intergenic
1026316027 7:69228431-69228453 GCTGCACAGCAGAAGGTGAGCGG - Intergenic
1026565060 7:71483010-71483032 GCTGCACAGCAGGAGGTGAGCGG - Intronic
1027279599 7:76597492-76597514 GCTGCTAGGCAGAAACTATGGGG - Intergenic
1027346587 7:77266490-77266512 ACTGCAAATGGGAAAGTGTGTGG + Intronic
1027352924 7:77330028-77330050 ACTGAAAAGCAGAAAGTTTAAGG - Intronic
1028659710 7:93255474-93255496 GCTACACAGCAGGAAGTGAGTGG - Intronic
1028798895 7:94938113-94938135 GCTGCATAGCAGGAGGTGAGTGG + Intronic
1029480187 7:100807580-100807602 GCTGGAGAGCAGATAGGGTGGGG + Exonic
1030720737 7:112867880-112867902 GCTGCATAGCAGGAGGTGAGCGG + Intronic
1030904008 7:115160338-115160360 GCTGCAAAGCAGGAAGTGAGTGG + Intergenic
1031799938 7:126230264-126230286 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
1032515120 7:132501131-132501153 GCTGCTGAGCAGAGTGTGTGGGG + Intronic
1032795607 7:135273782-135273804 GCTGCACAGCAGAAGGTGAGTGG - Intergenic
1033452796 7:141476748-141476770 GCTGCAAAGCAGAAAGTGTGCGG - Exonic
1034635110 7:152561006-152561028 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1034810688 7:154129395-154129417 GCTGCTAAGCAGAAAGCGACAGG + Intronic
1035063267 7:156085542-156085564 GCTGCAAAGCAAAGAGGATGTGG + Intergenic
1035483703 7:159206201-159206223 GCTGCAAAGGAGAGAGAGAGAGG + Intergenic
1035791714 8:2312175-2312197 GCTGCAGAGCAGGAGGTGAGTGG - Intergenic
1035801091 8:2409530-2409552 GCTGCAGAGCAGGAGGTGAGTGG + Intergenic
1035938363 8:3868117-3868139 TCTGCCAAGCAGAAAGTGCTAGG - Intronic
1036692549 8:10952843-10952865 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1037207695 8:16343361-16343383 GCTACACAGCAGGAAGTGAGTGG + Intronic
1037254405 8:16936258-16936280 GCTGCATAGCAGGAGGTGAGTGG - Intergenic
1037603607 8:20419512-20419534 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1037736381 8:21570221-21570243 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1038285243 8:26200544-26200566 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1038345849 8:26731786-26731808 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1038499969 8:28035645-28035667 GCTGCAGAGGTGACAGTGTGTGG - Intronic
1038863633 8:31414881-31414903 GCTGAAAAGCAGGAGGTGAGTGG - Intergenic
1039070723 8:33647227-33647249 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1039375514 8:37028763-37028785 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1039377162 8:37045968-37045990 GTTGCAAAAGAGAAAGTGGGAGG - Intergenic
1040010687 8:42658864-42658886 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1040328520 8:46374424-46374446 GCAGGAAAGCAGAAACTGAGGGG - Intergenic
1040929937 8:52722813-52722835 GCTGCAAAGGATAAATTCTGTGG + Intronic
1041040972 8:53845298-53845320 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1041628382 8:60057181-60057203 GCTGCTCAGCAGAATATGTGAGG + Intergenic
1041646572 8:60258870-60258892 GCTGCACAGCACAAGGTGAGTGG - Intronic
1041860060 8:62503016-62503038 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1041928271 8:63260304-63260326 GCTGCACAGTAGGAAGTGAGTGG + Intergenic
1042084618 8:65093983-65094005 AATGCAAAGCAGACAGTATGTGG - Intergenic
1042273133 8:66975991-66976013 GCCGCATAGCAGAAGGTGAGTGG + Intronic
1042406188 8:68408016-68408038 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1042718647 8:71803388-71803410 GCTGGAGAGCAGAGAGTGAGGGG + Intergenic
1042981418 8:74533171-74533193 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1043225846 8:77729198-77729220 GCTGAATAGCAGAAACTCTGAGG - Intergenic
1043583577 8:81740475-81740497 GCTGCAAAGCAGGAGATGAGCGG - Intronic
1043794583 8:84520601-84520623 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1043849370 8:85198639-85198661 GAAGAAAATCAGAAAGTGTGGGG - Intronic
1044937744 8:97309297-97309319 GTTGCACAGCAGAAAGTGAGTGG + Intergenic
1045249168 8:100468790-100468812 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1045334013 8:101182143-101182165 GCTGCACAGCAGGAGGTGAGGGG - Intronic
1045531483 8:102989229-102989251 GCTGCACAGCAGGGAGTGAGTGG + Intergenic
1045672446 8:104571290-104571312 GCAGCACAGCAGCAAGTGAGTGG + Intronic
1046212036 8:111089030-111089052 GCTGTAAAGCAGAAGTTTTGGGG - Intergenic
1046313493 8:112469715-112469737 GCCGCACAGCAGGAAGTGAGTGG - Intronic
1046423186 8:114011555-114011577 GCTGCCTAGCAGGAAGTGAGTGG - Intergenic
1046858590 8:119065200-119065222 GCTGTACAGCAGGAGGTGTGCGG + Intronic
1047177259 8:122553663-122553685 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1047260789 8:123257778-123257800 GCCGCACAGCAGAAGGTGAGAGG - Intronic
1047492009 8:125382821-125382843 GTTGATAAGCAGAAAGGGTGGGG + Intergenic
1047514030 8:125538009-125538031 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1047941716 8:129832904-129832926 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1047982191 8:130194811-130194833 GCTGCATAGCAGGAGGTGAGCGG - Intronic
1048071797 8:131028989-131029011 GTTGCACAGCAGCAAGTGAGAGG + Intronic
1048296203 8:133216137-133216159 GCAGGAAAGAAGAGAGTGTGGGG + Intronic
1048445261 8:134488517-134488539 ACTCCAAAGCAGAGAGTGGGTGG - Intronic
1048930612 8:139312633-139312655 TTTGCAAAGCAGTAAGTGTGAGG - Intergenic
1049403493 8:142441348-142441370 GCTCCAAAGCAGAGGCTGTGTGG - Intergenic
1049534812 8:143174063-143174085 ACTCCAGAGCAGGAAGTGTGTGG - Intergenic
1050057027 9:1666393-1666415 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1050364591 9:4862574-4862596 GCTGCAAACCTGGAAGTGTCTGG + Intronic
1050597153 9:7215495-7215517 TCTGCAAAGCAGTGAGTGTCAGG + Intergenic
1050822639 9:9900285-9900307 GCTGCAAAGCATGCAGTATGTGG - Intronic
1050931161 9:11328464-11328486 GCTGCACAGCAGGAGGTGAGCGG + Intergenic
1051261746 9:15271628-15271650 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1051378633 9:16431931-16431953 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1051614060 9:18990633-18990655 GCTGCACAGCAGAAGGTGAGTGG + Intronic
1052565522 9:30145133-30145155 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1053514301 9:38716952-38716974 GATGGAAAGCACACAGTGTGGGG - Intergenic
1055381894 9:75716388-75716410 AATGCAAAGGAGAAAGGGTGTGG - Intergenic
1055657293 9:78463990-78464012 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1055767858 9:79684351-79684373 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1056115066 9:83433888-83433910 GCTGCACAGCAGGAGGTGAGTGG - Intronic
1056189181 9:84167854-84167876 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1057959230 9:99438660-99438682 GCTGCAAAGGAGAATGTCTCAGG - Intergenic
1058985992 9:110208519-110208541 GCTGGCAAGCAGAGAGTGAGGGG - Intergenic
1059017285 9:110533142-110533164 GCTGCATAGCAGGAGGTGAGCGG - Intronic
1059552107 9:115239571-115239593 GTAGCAAAGCAGAGAGAGTGAGG + Intronic
1060346008 9:122816391-122816413 GCTGCACAGCAGGAAGTGAGCGG - Intronic
1060367986 9:123039149-123039171 GCTTCAAAGATCAAAGTGTGGGG - Intronic
1062365014 9:136204334-136204356 GGTGCAAAGCCGAGTGTGTGCGG + Intronic
1185708781 X:2285569-2285591 GCCGCACAGCAGAAGGTGAGTGG - Intronic
1185815422 X:3150690-3150712 GCTTTTAAGCAGAAAGTGGGAGG - Intergenic
1185834865 X:3335977-3335999 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1187557701 X:20367796-20367818 GCTGCAAAGCAGGAGGTGAGTGG + Intergenic
1187650996 X:21406074-21406096 GCGGCACAGCAGGAGGTGTGTGG + Intronic
1187977979 X:24723312-24723334 GCTGCAAAACACAGAATGTGTGG - Intronic
1188131862 X:26445770-26445792 ACTGTAAAGTATAAAGTGTGCGG + Intergenic
1188334604 X:28915223-28915245 GCTGCAGAGCAGGAGGTGAGTGG - Intronic
1188904270 X:35773527-35773549 GCTGCACAGCAGGAGGTGAGTGG + Intergenic
1188951408 X:36379367-36379389 GCTGCCAGGTAGGAAGTGTGCGG - Exonic
1189382597 X:40512536-40512558 GCTGCACAGCAGTAGGTGAGTGG + Intergenic
1191129132 X:56989564-56989586 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1192529585 X:71873139-71873161 GCTGCACAGCAGCAAGGGCGAGG - Intergenic
1194302909 X:92209538-92209560 GCTGCAAAGCTGCAGGAGTGGGG - Intronic
1195016478 X:100786585-100786607 GCTGCAAAGTAGCAAAAGTGGGG + Intergenic
1195493254 X:105498873-105498895 GCTGCAAAGCAGGAGGTGAGTGG + Intronic
1196495113 X:116315973-116315995 AGTGCAAAGGAGAAAGTGGGTGG + Intergenic
1196641729 X:118070284-118070306 ACTGCATAGCAAAACGTGTGAGG - Intronic
1196872324 X:120124860-120124882 GCTGCACAGCAGGAGGTGAGTGG - Intergenic
1197408206 X:126081877-126081899 GCTGCAGAACAAAAAGTTTGAGG + Intergenic
1198013104 X:132579896-132579918 GCTTCAAGGTAGAATGTGTGTGG - Intergenic
1198271273 X:135058554-135058576 GCCGCACAGCAGAAGGTGAGTGG + Intergenic
1198733337 X:139758450-139758472 GCTGCACAGCAGGAGGTGAGTGG + Intronic
1199481718 X:148305361-148305383 GCTGCAAAGCTTGAAGTGGGTGG - Intergenic
1199523359 X:148763402-148763424 CCTTCAAAGTAGAAAGTGTTTGG - Intronic
1199605803 X:149578834-149578856 GCTGCACAGCAGGAAGTGAGTGG + Intergenic
1199633318 X:149790534-149790556 GCTGCACAGCAGGAAGTGAGTGG - Intergenic
1201332303 Y:12837694-12837716 GCTGCACAGCAGCCAGTGAGTGG - Intronic