ID: 1033454319

View in Genome Browser
Species Human (GRCh38)
Location 7:141488905-141488927
Sequence TTCCTTATTTTCTCCAACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033454319_1033454331 22 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454331 7:141488950-141488972 GAGAAAGAGAAGGAGGAGGGAGG No data
1033454319_1033454324 -6 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454324 7:141488922-141488944 AAGGAAAAGGCAAAAGAATAAGG No data
1033454319_1033454326 0 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454326 7:141488928-141488950 AAGGCAAAAGAATAAGGAGGAGG No data
1033454319_1033454328 15 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454328 7:141488943-141488965 GGAGGAGGAGAAAGAGAAGGAGG 0: 15
1: 177
2: 1515
3: 6349
4: 14847
1033454319_1033454327 12 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454327 7:141488940-141488962 TAAGGAGGAGGAGAAAGAGAAGG 0: 2
1: 19
2: 239
3: 1933
4: 6657
1033454319_1033454333 28 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454333 7:141488956-141488978 GAGAAGGAGGAGGGAGGAGGAGG No data
1033454319_1033454325 -3 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454325 7:141488925-141488947 GAAAAGGCAAAAGAATAAGGAGG No data
1033454319_1033454332 25 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454332 7:141488953-141488975 AAAGAGAAGGAGGAGGGAGGAGG No data
1033454319_1033454330 19 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG No data
1033454319_1033454329 18 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454329 7:141488946-141488968 GGAGGAGAAAGAGAAGGAGGAGG 0: 7
1: 171
2: 1505
3: 6956
4: 15673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033454319 Original CRISPR TTCCTTATTTTCTCCAACGG GGG (reversed) Intergenic
No off target data available for this crispr