ID: 1033454330

View in Genome Browser
Species Human (GRCh38)
Location 7:141488947-141488969
Sequence GAGGAGAAAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033454319_1033454330 19 Left 1033454319 7:141488905-141488927 CCCCCGTTGGAGAAAATAAGGAA No data
Right 1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG No data
1033454321_1033454330 17 Left 1033454321 7:141488907-141488929 CCCGTTGGAGAAAATAAGGAAAA No data
Right 1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG No data
1033454320_1033454330 18 Left 1033454320 7:141488906-141488928 CCCCGTTGGAGAAAATAAGGAAA No data
Right 1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG No data
1033454322_1033454330 16 Left 1033454322 7:141488908-141488930 CCGTTGGAGAAAATAAGGAAAAG No data
Right 1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033454330 Original CRISPR GAGGAGAAAGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr