ID: 1033454873

View in Genome Browser
Species Human (GRCh38)
Location 7:141493571-141493593
Sequence CAAACCACAAGGAGAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033454870_1033454873 7 Left 1033454870 7:141493541-141493563 CCAGGAAGATCTTCTCAATTCTG No data
Right 1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG No data
1033454866_1033454873 25 Left 1033454866 7:141493523-141493545 CCCACCTGCGGCTGCAGTCCAGG No data
Right 1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG No data
1033454868_1033454873 24 Left 1033454868 7:141493524-141493546 CCACCTGCGGCTGCAGTCCAGGA No data
Right 1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG No data
1033454869_1033454873 21 Left 1033454869 7:141493527-141493549 CCTGCGGCTGCAGTCCAGGAAGA No data
Right 1033454873 7:141493571-141493593 CAAACCACAAGGAGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033454873 Original CRISPR CAAACCACAAGGAGAACTGC AGG Intergenic
No off target data available for this crispr