ID: 1033463026

View in Genome Browser
Species Human (GRCh38)
Location 7:141564568-141564590
Sequence CTGTAGTTCAGGATGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8008
Summary {0: 1, 1: 1, 2: 85, 3: 1311, 4: 6610}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033463023_1033463026 2 Left 1033463023 7:141564543-141564565 CCATGACACATGGGGATTATGGG 0: 583
1: 1483
2: 2686
3: 4340
4: 5719
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463019_1033463026 7 Left 1033463019 7:141564538-141564560 CCCTCCCATGACACATGGGGATT 0: 461
1: 1311
2: 2947
3: 5417
4: 6880
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463014_1033463026 16 Left 1033463014 7:141564529-141564551 CCATTGGGCCCCTCCCATGACAC 0: 1
1: 27
2: 454
3: 1354
4: 3531
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463021_1033463026 3 Left 1033463021 7:141564542-141564564 CCCATGACACATGGGGATTATGG 0: 409
1: 1259
2: 2526
3: 4365
4: 5835
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463020_1033463026 6 Left 1033463020 7:141564539-141564561 CCTCCCATGACACATGGGGATTA 0: 444
1: 1505
2: 3073
3: 5002
4: 6462
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463013_1033463026 20 Left 1033463013 7:141564525-141564547 CCTTCCATTGGGCCCCTCCCATG 0: 1
1: 6
2: 83
3: 796
4: 1714
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610
1033463018_1033463026 8 Left 1033463018 7:141564537-141564559 CCCCTCCCATGACACATGGGGAT 0: 25
1: 77
2: 291
3: 591
4: 935
Right 1033463026 7:141564568-141564590 CTGTAGTTCAGGATGAGATTTGG 0: 1
1: 1
2: 85
3: 1311
4: 6610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033463026 Original CRISPR CTGTAGTTCAGGATGAGATT TGG Intronic
Too many off-targets to display for this crispr