ID: 1033463350

View in Genome Browser
Species Human (GRCh38)
Location 7:141567685-141567707
Sequence ATAATCTTCCCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033463350_1033463354 -7 Left 1033463350 7:141567685-141567707 CCAGCTTCCCTGGGGAAGATTAT 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1033463354 7:141567701-141567723 AGATTATGTTCCAGGTTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033463350 Original CRISPR ATAATCTTCCCCAGGGAAGC TGG (reversed) Intronic
900876676 1:5347832-5347854 CTAATCCTCCCTAGGGAGGCTGG - Intergenic
901484133 1:9546604-9546626 ATAATCTTCCAAAGGCCAGCTGG - Intronic
902470701 1:16646186-16646208 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
902488103 1:16761274-16761296 AAAAATTTCCCCTGGGAAGCAGG + Intronic
904689722 1:32284821-32284843 TTAATTTACACCAGGGAAGCAGG + Intronic
907299647 1:53478582-53478604 AAATTCATCCCCAGGGAATCTGG - Intergenic
909898320 1:81102126-81102148 ATAATCTGCCTGAGAGAAGCAGG + Intergenic
909999625 1:82326938-82326960 ATACTGGTCCCCAGGCAAGCAGG - Intergenic
912762350 1:112380241-112380263 TTTCTCTTCCCCAGGTAAGCAGG + Intergenic
914198801 1:145466154-145466176 ATGGTCTTCCCCAAAGAAGCGGG + Intergenic
914241448 1:145855787-145855809 ATAATCTTCCTGGGGGCAGCTGG + Exonic
914477910 1:148039290-148039312 ATGGTCTTCCCCAAAGAAGCGGG + Intergenic
920054100 1:203180408-203180430 ATCACCTTCCCCAGGGCTGCTGG + Intronic
920124273 1:203681256-203681278 AGAAGCTTCCACAGGGATGCAGG - Intronic
920522988 1:206643002-206643024 ATCATCTTCTCCAGTGAATCTGG - Intronic
921706213 1:218324447-218324469 ATTATCTGCCTCAGGGACGCGGG + Intronic
922342969 1:224672240-224672262 ATACACCTCCCCAGGGAAGCAGG - Intronic
922755544 1:228094677-228094699 AGAAGCTCCCCCAGGGAACCAGG - Intronic
1065997165 10:31069829-31069851 AGAAACTTCCCCAGGGATGGGGG - Intergenic
1069550828 10:69362840-69362862 ATGACCCTCCCCAGAGAAGCCGG - Intronic
1071502111 10:86211551-86211573 AACATCTTCTCCAGGGAAGCAGG - Intronic
1076637336 10:131891099-131891121 ATATGCGTCCCCAGGGAAGTTGG - Intergenic
1077229526 11:1452457-1452479 ATTATCTTCCTCAGAGAAGGTGG + Intronic
1078451522 11:11444103-11444125 ACAACTCTCCCCAGGGAAGCCGG + Intronic
1083292658 11:61698577-61698599 GTGAGCTTCCCCAGGGAAGCAGG - Intronic
1085149707 11:74240093-74240115 GAAAGCTTCCCCAGGGAAGTTGG - Intronic
1090897981 11:130996309-130996331 ATAATATTCACTAGGGAAGTGGG - Intergenic
1092150350 12:6243827-6243849 AAAAGCTTCCCCTGGCAAGCTGG + Intergenic
1092462789 12:8700496-8700518 ATCATCTTCCTCTGGGGAGCAGG + Exonic
1093944946 12:25098046-25098068 ATAAGCTTGGCCAGGAAAGCAGG - Intronic
1094402284 12:30074900-30074922 ATGATCTTCCAGAGAGAAGCAGG + Intergenic
1097927657 12:65147772-65147794 TCAAACTTCCCCAGGGAAGATGG + Intergenic
1098162416 12:67658166-67658188 TTCATCTTCCCCAGGCAAGAGGG - Exonic
1101498666 12:105280415-105280437 AGAAACTTCCCCAGGGATGAAGG - Intronic
1102269056 12:111515197-111515219 ACAGTTTTCTCCAGGGAAGCAGG + Intronic
1102270593 12:111531487-111531509 ACAGGCTTCCCCAGGGAAGTGGG + Intronic
1102867132 12:116383288-116383310 ATAAACTTTCCCAAGGAGGCTGG - Intergenic
1105461676 13:20595842-20595864 CTCATCTTGCCCAGGGAGGCTGG - Intronic
1106044541 13:26126440-26126462 GTCATCTGCCCCAGGGAGGCAGG + Intergenic
1106470372 13:30049099-30049121 TCAATCTTCCCCAAGGAAGGAGG + Intergenic
1106479002 13:30123018-30123040 ACGAACCTCCCCAGGGAAGCGGG - Intergenic
1106936250 13:34724214-34724236 ATCACCTTTCCCAGGGAGGCAGG - Intergenic
1107875071 13:44783167-44783189 ATAATCTTCCCCTGGCCAGCCGG + Intergenic
1107977288 13:45702494-45702516 ATCATCTTAGACAGGGAAGCAGG + Intronic
1109922711 13:69089903-69089925 ATATCATTCCCAAGGGAAGCAGG + Intergenic
1111462036 13:88558147-88558169 ATAAGTTTTGCCAGGGAAGCAGG + Intergenic
1112689573 13:101876286-101876308 ATAATCTTCACCATGGCAACTGG + Intronic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1114619423 14:24086275-24086297 ACATGCCTCCCCAGGGAAGCTGG - Intronic
1120736373 14:88057560-88057582 ATACAGATCCCCAGGGAAGCGGG + Intergenic
1120924608 14:89785183-89785205 ACACTGGTCCCCAGGGAAGCTGG + Intergenic
1127269804 15:57390307-57390329 GTAATCTGCCCAAGGCAAGCTGG - Intronic
1127691915 15:61404915-61404937 ATAACTTTCCCGAGGGCAGCTGG + Intergenic
1128571332 15:68735393-68735415 ACAAGCTGCCCCATGGAAGCAGG + Intergenic
1130930907 15:88426975-88426997 TTACTCTTACCTAGGGAAGCGGG - Intergenic
1134256729 16:12618595-12618617 AAGATCTGCCCCAGGGAAGGGGG + Intergenic
1134832130 16:17332143-17332165 ACAGTCAGCCCCAGGGAAGCAGG - Intronic
1135350838 16:21727760-21727782 CTGATCTTCCCCAGGGATGCAGG - Intronic
1136865001 16:33741317-33741339 ATTATTTTCCTCAGGGAAGAAGG - Intergenic
1136865130 16:33743192-33743214 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1136995432 16:35185733-35185755 AAAATCTTCCCCAAAGATGCTGG + Intergenic
1137034674 16:35559696-35559718 TTAAAATTCCCCAGGTAAGCAGG + Intergenic
1137805108 16:51297518-51297540 ATGATCTTCCCCAGGGCAATTGG - Intergenic
1141499377 16:84433081-84433103 AAAATCTTCCCCAAGTAGGCTGG + Intronic
1141682475 16:85552758-85552780 ATAGTCTTCCCCACTGCAGCAGG + Intergenic
1141778609 16:86141618-86141640 ATGATCTTCCACAGGAAAGATGG + Intergenic
1203126499 16_KI270728v1_random:1589460-1589482 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1148111259 17:45145720-45145742 AGAATCTTCCCCAAGGGGGCCGG - Intergenic
1148451846 17:47783650-47783672 ATGATCTGCCCCTGGAAAGCTGG - Intergenic
1153521091 18:5954541-5954563 ATATATTTCCCAAGGGAAGCAGG - Intergenic
1156462121 18:37326997-37327019 ATAATCGTCCCCAAGGAGGCTGG - Intronic
1166796109 19:45427311-45427333 ATAATTTTCCCCCAGGAGGCCGG + Intronic
1167868004 19:52343973-52343995 ATAACATTCTCCAGGGGAGCTGG + Intronic
1202703096 1_KI270713v1_random:2966-2988 AAAAATTTCCCCTGGGAAGCAGG - Intergenic
926686741 2:15704090-15704112 ACCAGCTTCCCCAGGGAGGCTGG + Intronic
927992540 2:27458255-27458277 ATCCAATTCCCCAGGGAAGCAGG + Intronic
930257340 2:49107448-49107470 ATAATTAGCCCCAGGAAAGCAGG + Intronic
932024868 2:68122636-68122658 ATTTTCTTCCCCTGGGAAGGAGG - Intergenic
934633519 2:95958127-95958149 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934633645 2:95960009-95960031 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934707950 2:96497836-96497858 ATAAAGTTCCACATGGAAGCTGG - Exonic
934799981 2:97145151-97145173 ATTATTTTCCTCAGGGAAGAGGG + Intronic
937999272 2:127719617-127719639 ATAATCATCCCTTGGGGAGCAGG + Exonic
939029480 2:137054512-137054534 ATATACATCCCCAGAGAAGCAGG - Intronic
939474735 2:142673211-142673233 ATAACCTCCCCCAGGCAAGAGGG - Intergenic
940911732 2:159215483-159215505 ACAATAATGCCCAGGGAAGCTGG - Intronic
941864210 2:170317149-170317171 ATAGCCTTCCCCAGGAAGGCTGG + Intronic
941934061 2:170969704-170969726 AAAAACTTCCCCAGGGAGGGTGG + Intergenic
943747769 2:191480049-191480071 ATCAGATTCACCAGGGAAGCAGG - Intergenic
944778185 2:202990608-202990630 ATAATTTTCCCCAGGTCATCTGG + Intronic
947023691 2:225712694-225712716 CTATTCTTCCCTAGGGAAGGAGG + Intergenic
948253674 2:236551014-236551036 AGAAACTTCCACAGGGAAGAAGG - Intergenic
948391589 2:237615281-237615303 AGAATCCTCCCCAGTGAACCTGG - Intergenic
1172361411 20:34315222-34315244 ATAATTTTCTCAAGAGAAGCTGG - Intergenic
1173085578 20:39912975-39912997 ATGAGCTTGCCTAGGGAAGCAGG + Intergenic
1174726211 20:52864874-52864896 ATAATCCTCCACATGAAAGCAGG + Intergenic
1175111106 20:56648549-56648571 CTCATCTTCCCTAAGGAAGCAGG - Intergenic
1178940792 21:36903404-36903426 ATCACTTTCCCCAGGGCAGCTGG + Intronic
1179547274 21:42121186-42121208 AGAATATTCCACAGGGAAGTCGG - Exonic
949459605 3:4276101-4276123 ATAAATTTCCCCAGGGAAGATGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949960117 3:9304888-9304910 ATATTATTCCCCAGGTGAGCAGG - Intronic
953970197 3:47341496-47341518 TTCATCTTCCCCAGGGTTGCAGG + Intronic
954298730 3:49688068-49688090 AAAAATTTCCCCTGGGAAGCAGG + Intronic
960621060 3:119637189-119637211 TCTATCTTCCCCAGGGAAACTGG + Intronic
964390146 3:156188164-156188186 ATAAACTTACCAAGGGAAGCTGG - Intronic
967034417 3:185637448-185637470 ACATCCTTCCCCAGGGATGCAGG + Intergenic
969611992 4:8232592-8232614 AAACCCTGCCCCAGGGAAGCAGG - Intronic
970486133 4:16526444-16526466 ATCTTCAGCCCCAGGGAAGCTGG - Intronic
971082292 4:23227297-23227319 AGGATCTTCCACAGGGAAACAGG + Intergenic
973624475 4:52757646-52757668 TCACTCTTCCCCAGGGAAGGAGG + Intergenic
975516652 4:75255155-75255177 AAAGTCTTTCCCAGTGAAGCGGG + Intergenic
979578539 4:122325889-122325911 ATACCCTTCCCCAGGACAGCTGG - Intronic
983216521 4:165007537-165007559 ATCATCTGCTCCAGGTAAGCCGG + Intergenic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
986573410 5:9188719-9188741 TTAATTTTCCCCAGGGTACCCGG - Intronic
996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG + Intergenic
997364764 5:133318844-133318866 GGAATCTTGCCCAGGGCAGCAGG - Intronic
998225384 5:140322752-140322774 GTGATCTGCCCCAGGGAGGCAGG + Intergenic
999634804 5:153610435-153610457 TTTGTCTTCCCCAGGGAATCTGG - Intronic
1003765377 6:9230427-9230449 AAAATCTTTCCCAGGCAAGGAGG + Intergenic
1005668538 6:28081378-28081400 TTACTCTTCCCAAGGGAAGCAGG - Exonic
1006012520 6:31054560-31054582 ATCACCTGCCACAGGGAAGCAGG + Intergenic
1007028561 6:38604209-38604231 AAAATCTTTCCCAGAGAAGAAGG - Intronic
1008828410 6:55727991-55728013 ATAAGCATCCCCAGAGAACCAGG - Intergenic
1010621794 6:78085736-78085758 ATAATCTTCCCCTGGGGTTCAGG + Intergenic
1012004639 6:93697346-93697368 ATTATCTTGCTCAGTGAAGCGGG - Intergenic
1012645201 6:101670363-101670385 ATGTTATTCCCCAGGGAAACTGG + Intronic
1012894577 6:104933999-104934021 ATGACCTGCCTCAGGGAAGCAGG - Intergenic
1016560575 6:145391781-145391803 TTACTCTTCCCCAGTGCAGCTGG - Intergenic
1018202811 6:161410995-161411017 AAAATCTACTACAGGGAAGCAGG - Intronic
1021935210 7:25624086-25624108 AAAATCTTCTCCAGGGCAGGGGG - Intergenic
1025236900 7:57240608-57240630 GTCATCATCCCCAGGGGAGCAGG + Intergenic
1028334884 7:89639619-89639641 CCAATCTTCCACAGGGTAGCTGG + Intergenic
1029064983 7:97840439-97840461 ATGATCTACTCCAGGGAAGAAGG - Intergenic
1032900828 7:136305592-136305614 AAAATTTTCCCTGGGGAAGCTGG - Intergenic
1033265822 7:139886126-139886148 ATTATCTGCCCTAGGCAAGCAGG - Intronic
1033463350 7:141567685-141567707 ATAATCTTCCCCAGGGAAGCTGG - Intronic
1033737698 7:144239535-144239557 AAAATCTTGCCCAGGTAATCAGG + Intergenic
1033745358 7:144311422-144311444 AAAATCTTGCCCAGGTAATCAGG - Intergenic
1034505828 7:151490099-151490121 ATAATCTGAAGCAGGGAAGCTGG - Intronic
1034750750 7:153566764-153566786 ATAATCTTCAATAGGCAAGCTGG - Intergenic
1035287404 7:157815130-157815152 AGAATCTTCTGCAGGGAAACCGG - Intronic
1036183790 8:6607148-6607170 ATAACCTGCCCCAGGGGAGAAGG - Intronic
1037323691 8:17667776-17667798 AGTAACTTCCCAAGGGAAGCTGG - Intronic
1039518583 8:38152918-38152940 ATATTCTTGCCCAGTGAATCTGG - Intergenic
1039767299 8:40642876-40642898 AATATCTTCCCTAGGGAAACTGG - Intronic
1040759557 8:50822883-50822905 ATATTATTCTCCATGGAAGCAGG - Intergenic
1046735528 8:117772575-117772597 ATCATCATCCCCATGAAAGCTGG - Intergenic
1048301295 8:133253131-133253153 ATACCCTTCCCGAGGGTAGCTGG + Intronic
1048876234 8:138838726-138838748 AAAATGTTCCCGAGGAAAGCAGG + Intronic
1050570525 9:6933503-6933525 GTATTCTTCCCCTGGGAATCTGG + Intronic
1054928022 9:70607616-70607638 ATAAGATTCGCCTGGGAAGCTGG + Intronic
1057442827 9:95094440-95094462 TTCATCTTCCCCAGTGAAACGGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057629619 9:96708715-96708737 ATATTCTTCTTCAGTGAAGCAGG - Intergenic
1060458580 9:123825785-123825807 ATAATTTTCTCCAGGAAAGAGGG - Intronic
1186720288 X:12296736-12296758 AACATCTACCCCAGGGACGCTGG - Intronic
1189653699 X:43218300-43218322 ATAATCTGCCTCAGGGGAGAAGG - Intergenic
1197660501 X:129166082-129166104 TTATTCTTCCCCAGTGAAGGTGG + Intergenic
1202586858 Y:26439445-26439467 ATTATTTTCCTCAGGGAAGAGGG + Intergenic