ID: 1033469944

View in Genome Browser
Species Human (GRCh38)
Location 7:141637469-141637491
Sequence TGTATTGGAGAGTATAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033469942_1033469944 2 Left 1033469942 7:141637444-141637466 CCAGCTAAATATGGGCGGTGGTT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG 0: 1
1: 0
2: 2
3: 17
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033469944 Original CRISPR TGTATTGGAGAGTATAGATA TGG Intronic
900608165 1:3533035-3533057 TGTAGTGGAGAGTGGAGAGAAGG - Intronic
902051272 1:13565359-13565381 TTTATTGGACAGTATAGAGGTGG - Intergenic
904149208 1:28423110-28423132 TACCTTAGAGAGTATAGATAGGG + Intronic
905265359 1:36750109-36750131 TGTATTGGACAGTGTAGTTCTGG + Intergenic
906765056 1:48422101-48422123 AGGATGGGAGAGTATAGAAAGGG + Intronic
910247767 1:85160209-85160231 TATATTGGAGAGTATAAAGTTGG - Intronic
910736581 1:90465057-90465079 TTTATTGGAGAGAAAACATAGGG - Intergenic
911639683 1:100274500-100274522 CATATTGGACAGCATAGATATGG - Intronic
913417957 1:118633253-118633275 TTTATTCTAGAGTATAGTTAAGG + Intergenic
916241193 1:162641851-162641873 TGTCTTTGTGAGTACAGATAAGG + Intronic
917133136 1:171762412-171762434 TGACCTGGAGGGTATAGATATGG + Intergenic
918682440 1:187372107-187372129 GGTATAAGAGAGTATAAATAGGG + Intergenic
919397049 1:197063885-197063907 TGTATTGGACAGTACAGTTCAGG + Intronic
920630988 1:207651350-207651372 AATATTGGACAGTATATATATGG + Intronic
921369407 1:214406128-214406150 TGTATTGGAAAGCTCAGATATGG - Intronic
921815020 1:219553638-219553660 TGTACTGGACAGTATAGATCTGG - Intergenic
923890769 1:238213045-238213067 TGCCTTGGAGATTGTAGATATGG - Intergenic
924113888 1:240726815-240726837 TATATTGGAAAGTATGGATCGGG + Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1065677694 10:28196139-28196161 TGGATTGGACAGAATAGATTTGG - Intronic
1066073227 10:31843460-31843482 TGTATTGGACACTAATGATAAGG - Exonic
1066247352 10:33596269-33596291 TCTATTGGAGAGTAATGAGAGGG + Intergenic
1067033556 10:42897297-42897319 TGTCTTTGTTAGTATAGATAAGG - Intergenic
1067071101 10:43132859-43132881 TCCATGGGAGAGTATAGAAAAGG - Intergenic
1067770473 10:49119389-49119411 TGTATTGTATAATATATATATGG + Intergenic
1068143142 10:53030344-53030366 TGGAATTGGGAGTATAGATAAGG + Intergenic
1070206140 10:74264109-74264131 TGTATTGGATATTGTGGATATGG + Intronic
1072321593 10:94255284-94255306 TGTACTGGATAGTACAGATTTGG - Intronic
1073950953 10:108808579-108808601 GGTATTGTAGAGTATACATTTGG - Intergenic
1074435504 10:113430927-113430949 TGTATTGGAGAGAAGAGAAAAGG + Intergenic
1074629965 10:115241773-115241795 TGTATTTGAGAATATCTATATGG - Intronic
1077212648 11:1379574-1379596 TGTACTGGAGATTCTAGACAGGG + Intergenic
1078516918 11:12030457-12030479 GGTATTGGTGAGTTTATATATGG - Intergenic
1078696647 11:13639754-13639776 TGTACTGGACAGTATAGTCAGGG - Intergenic
1079650277 11:22919915-22919937 TGGAATTGGGAGTATAGATAAGG + Intergenic
1080669379 11:34362169-34362191 TGTATTTGATAGCACAGATATGG - Intergenic
1081010698 11:37808200-37808222 TATATAGGAGAATATAGAAAAGG + Intergenic
1081181477 11:39990542-39990564 TGGAATTGGGAGTATAGATAAGG - Intergenic
1081184823 11:40029268-40029290 TGGAATTGGGAGTATAGATAAGG - Intergenic
1081571823 11:44296141-44296163 TGTATTTGAGAGTTTACATCTGG - Intronic
1081796413 11:45823546-45823568 GGAGTTGGGGAGTATAGATAAGG - Intergenic
1082210052 11:49488693-49488715 GGTATTGTAGAGAATACATAGGG - Intergenic
1083178508 11:60969155-60969177 GGTAATTGAAAGTATAGATAAGG - Intergenic
1085149194 11:74234740-74234762 TGTATAGGAGAGCAGAGAAATGG + Intronic
1086667646 11:89503265-89503287 TGTATGGGAGAGTCTAGTTGAGG - Intergenic
1088270252 11:108027049-108027071 TGTATAAGAGAGTAAAGAAATGG - Intronic
1088428523 11:109731426-109731448 TGTATTGGATAGTTCAGATGTGG - Intergenic
1088951011 11:114569902-114569924 AGAGTTGGGGAGTATAGATAAGG - Intergenic
1089513332 11:119015253-119015275 TTTATTGAAGAATATAGAGATGG - Intronic
1089565014 11:119366418-119366440 AGTAATGGAGAGTTTAGAGATGG - Intronic
1090868904 11:130725770-130725792 TGTTTTGAAGAGAATAGATAGGG + Intergenic
1093930775 12:24953188-24953210 TGAATAGGAGAGTTTACATAAGG + Intergenic
1094281656 12:28746769-28746791 TGTATGGGAGAGCAGAGAAATGG + Intergenic
1094722560 12:33079233-33079255 TGGACTGAAGAGTATGGATAGGG + Intergenic
1097641190 12:62184332-62184354 TCTATTGGAAAGTATATATGAGG + Intronic
1098885750 12:75959235-75959257 TGTATTGGAATGTATAAACAAGG + Intergenic
1099027574 12:77484819-77484841 TGTATTGGACAGTAAAGGTTTGG + Intergenic
1101847121 12:108371487-108371509 TGTTTTGGAGAATGGAGATATGG - Intergenic
1103668855 12:122594335-122594357 TCTTGTGGAGAATATAGATATGG + Exonic
1104106468 12:125664554-125664576 TGCATTTGAGAGTCTGGATATGG - Intergenic
1105462380 13:20604365-20604387 TTTAATGGGGAGTAGAGATATGG + Intronic
1105572304 13:21614185-21614207 TGCATTGGAGAATTTACATAGGG - Intergenic
1106190376 13:27447465-27447487 TGTCTCGGAGAGTATAGTTGTGG - Intronic
1106895250 13:34293283-34293305 TGGATTGGACATTACAGATATGG - Intergenic
1108114488 13:47111717-47111739 GGAGTTGGGGAGTATAGATAAGG + Intergenic
1108945746 13:56020279-56020301 TGCATTGAAGAGGATAGAAAGGG - Intergenic
1111017199 13:82396991-82397013 TGGAATGGGGAGTAGAGATAAGG - Intergenic
1111087119 13:83390939-83390961 TGAAATGGAGAGTGTAGAAAAGG + Intergenic
1111201845 13:84948546-84948568 TGTGTAGGAGAGTAGAGAAATGG + Intergenic
1111745470 13:92263420-92263442 TGTATTGGAGAGGAAAAAGAAGG - Intronic
1112074461 13:95895405-95895427 TGAATTAGAGATTAAAGATATGG + Intronic
1113612213 13:111655105-111655127 TGGATTGGAGAGGAGAGATGGGG + Intronic
1114166570 14:20224624-20224646 TGTTTCGAAGACTATAGATAAGG - Exonic
1114866461 14:26599795-26599817 TGTAGTGGAAAGTATAGGGAAGG - Intergenic
1120352906 14:83386251-83386273 TGGAATTGGGAGTATAGATAAGG + Intergenic
1121756580 14:96408083-96408105 TGTAGTGGAGAGCACTGATAAGG - Intronic
1123829733 15:24122703-24122725 TGTACTGGAGGATATAGACATGG - Intergenic
1123835297 15:24184471-24184493 TGTACTGGAGAATGTAGACAGGG - Intergenic
1123844695 15:24286965-24286987 TGTACTGGAGGATATAGACATGG - Intergenic
1123850059 15:24345833-24345855 TGTACTGGAGAATGTAGACAGGG - Intergenic
1123854999 15:24400384-24400406 TGTACTGGAGAATGTAGACAGGG - Intergenic
1123871029 15:24573326-24573348 TGTACTGGAGAATGTAGACAGGG - Intergenic
1125172007 15:36776272-36776294 TGTATTGGAGAGAATATTCAGGG + Intronic
1125316525 15:38438211-38438233 GGAGTTGGGGAGTATAGATAAGG + Intergenic
1126808667 15:52378989-52379011 TGTATGGGACAGTAGAGAAATGG - Intronic
1127250204 15:57226924-57226946 TGTATTGTACAGCATAGATACGG + Intronic
1128217691 15:65945632-65945654 TGTATTGGAGAACAGTGATACGG + Intronic
1131316383 15:91341783-91341805 TGTCTTGGAGAATGTAGAAAGGG + Intergenic
1133550458 16:6849493-6849515 TGTATTGTTTAGTAGAGATAGGG - Intronic
1133617663 16:7493297-7493319 TGTGTTAGACAGTACAGATATGG + Intronic
1134755271 16:16661551-16661573 TGTTATGTAGAGGATAGATAGGG + Intergenic
1134990794 16:18697620-18697642 TGTTATGTAGAGGATAGATAGGG - Intergenic
1137328183 16:47461964-47461986 GATATTGAAGAGTATAGTTAGGG + Intronic
1138083333 16:54112474-54112496 TGTATTGGACGGTACAGATATGG + Exonic
1146328633 17:31908988-31909010 TGTATTGGATAGTGCAGATGTGG - Intergenic
1150372290 17:64650504-64650526 TGTTGTGGAGAGTATAGAATTGG - Intronic
1153456197 18:5285100-5285122 AGGAGAGGAGAGTATAGATAGGG + Intergenic
1153538776 18:6133200-6133222 TGTATTGGACAGCAAAGATATGG - Intronic
1155210428 18:23596002-23596024 TGTAATGGAGATTATGGATAAGG - Intergenic
1156003078 18:32407576-32407598 TGTACTGGAGATTCTAGCTAGGG - Intronic
1156104717 18:33646298-33646320 TGAATTGGATGGTACAGATATGG + Exonic
1158233604 18:55287294-55287316 TGTGATGGGGTGTATAGATATGG - Intronic
1159256778 18:65957169-65957191 TTTATTGGAGAGTAAAGAAGAGG + Intergenic
1159713175 18:71789047-71789069 TGTATTTGTTAGTAGAGATAGGG - Intergenic
1160702834 19:516805-516827 GGAGTTGGAGAGTATAGATAAGG + Intronic
1162297058 19:9820480-9820502 TTTATTGGTGAGTATTAATAGGG - Intronic
1164236587 19:23342438-23342460 AGTATTGGATAGTAGAGCTAAGG - Intronic
1164288366 19:23842983-23843005 AGTATTGGATAGTAGAGCTAAGG + Intergenic
1164850220 19:31477105-31477127 TGGATTGGAGAGTTTGGATGAGG - Intergenic
1167639909 19:50675364-50675386 CAAATTGGACAGTATAGATATGG + Intronic
926769400 2:16355160-16355182 TGTATTGAAGAGTTTTGCTAGGG - Intergenic
927957073 2:27214866-27214888 TGTACTGGTTAGTACAGATACGG - Intronic
930057330 2:47262095-47262117 TGAACTGGACGGTATAGATATGG + Intergenic
938201733 2:129377896-129377918 TGTGCTGGAGACTATAGTTAAGG + Intergenic
941091753 2:161184885-161184907 TGAATTGGAAAGTGTAGATATGG + Intronic
941456737 2:165718236-165718258 TGTATTGGGGAGTAGGGATTTGG + Intergenic
943769672 2:191703056-191703078 TCTATTGGAAAGTTTAGATCTGG + Intergenic
944332258 2:198484327-198484349 TGTATTAAAGAGTATAAATGAGG - Intronic
1172191924 20:33067237-33067259 TGTCTTGGAGAGGAAAGAAAAGG + Intronic
1176987256 21:15451882-15451904 TGAATTGGAGTGTTGAGATAGGG + Intergenic
1182188571 22:28434509-28434531 TGGAATGGAGAGTAGAGATGGGG - Intronic
1184359262 22:44004463-44004485 GGAGTTGGGGAGTATAGATAAGG - Intronic
950035036 3:9879074-9879096 GGTATTGGAGAGTATGTACAAGG - Intronic
951422601 3:22505120-22505142 TGTTTTGGAGAGGATAAATGTGG - Intergenic
952567689 3:34679226-34679248 GGAGGTGGAGAGTATAGATAAGG - Intergenic
954691901 3:52400128-52400150 TGTATTGGGGACTGAAGATAGGG - Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955743464 3:62116997-62117019 TGTGTTTTAGTGTATAGATATGG - Intronic
956391427 3:68777375-68777397 CATATTGGACAGTATAAATATGG - Intronic
957324321 3:78672957-78672979 TGTATTGGAGAGAGTAGATATGG - Intronic
957861660 3:85959703-85959725 AGTATTTGAGTGTATAGACATGG - Intronic
958486897 3:94724156-94724178 GATATTGGAGAGTAGAAATATGG + Intergenic
959109078 3:102100135-102100157 TGTATTGGACAGTGTAGCTGTGG + Intronic
960684953 3:120286495-120286517 TGTCTTGCAGAATATAGAGAGGG - Intergenic
961161775 3:124732549-124732571 TGTATTGGAAAGCATATTTACGG - Intronic
962296290 3:134191208-134191230 TGAATTGGAGGGTATTGATTAGG - Intronic
965076333 3:163981942-163981964 TGATTTAGAGAGTATAGATTTGG - Intergenic
965306361 3:167068990-167069012 TGGATCGGAGAGTAAAGAAAGGG + Intergenic
965722826 3:171680406-171680428 TGTATTTGATAGTAGAGACAGGG + Intronic
966649964 3:182289475-182289497 TGTACTGGACACTGTAGATATGG - Intergenic
966811626 3:183851119-183851141 TGTATTTGAGATTTGAGATAGGG - Intronic
970082254 4:12300705-12300727 TGTGTTTGTGTGTATAGATAGGG + Intergenic
970495429 4:16620157-16620179 TGTTTTGGACATTAAAGATATGG - Intronic
970732633 4:19124987-19125009 TGTTGTGTAGAGAATAGATATGG + Intergenic
971550022 4:27941285-27941307 TCTCTTGTTGAGTATAGATATGG + Intergenic
972761853 4:42114199-42114221 TGTATTGGATAGTGTAGGTCAGG - Exonic
974520997 4:62979497-62979519 TGGAATTGGGAGTATAGATAAGG + Intergenic
975029043 4:69590976-69590998 TATAGTGTAGAGTATATATATGG - Intronic
975231474 4:71939265-71939287 TGTTATGGAGACTATAGATAGGG + Intergenic
975356010 4:73405466-73405488 TGTATTGGACAGTACAGCTCTGG + Intronic
975797058 4:78017781-78017803 TGTAATAGAGAGTAATGATATGG + Intergenic
976176546 4:82359470-82359492 AGAATCGGAGAGTGTAGATAAGG - Exonic
978008082 4:103643265-103643287 TGTGTTGGATAGTTCAGATATGG + Intronic
978231881 4:106409690-106409712 TGGAATTGGGAGTATAGATAAGG - Intergenic
978454364 4:108871687-108871709 TGTATCAGAATGTATAGATACGG - Intronic
978953342 4:114588508-114588530 GGAGTTGGGGAGTATAGATAAGG + Intergenic
978954339 4:114596152-114596174 GGAGTTGGGGAGTATAGATAAGG + Intergenic
979642823 4:123029551-123029573 GATATTGGAGAGTAAAGATGGGG + Intronic
982851939 4:160328587-160328609 TTTATTGGACAATATAGAAATGG - Intergenic
983411904 4:167410095-167410117 TGCATGGGAGAATATATATATGG - Intergenic
984290594 4:177789196-177789218 TGGAATTGGGAGTATAGATAAGG - Intronic
984323812 4:178226635-178226657 TGGAATTGGGAGTATAGATAAGG + Intergenic
984405286 4:179321091-179321113 TTTATTGGAAGGTATAGATCTGG - Intergenic
984533962 4:180949907-180949929 TGTTTTTGAGAGTATGGAAAAGG + Intergenic
985920512 5:2968112-2968134 TGTATTTCAGGGTATAGAGAAGG - Intergenic
986889732 5:12287787-12287809 TTTATTGTAGAATCTAGATAGGG - Intergenic
987987220 5:25162830-25162852 TGGAATGGGGAGTATAGATAAGG - Intergenic
989228618 5:39060743-39060765 TGTATTGTAGAGTATTGATTTGG - Intronic
989246409 5:39259856-39259878 TGCATTGGACACTCTAGATAGGG + Intronic
989607026 5:43254298-43254320 TGGATTTGAGAGTAAATATATGG + Intronic
996092006 5:119360643-119360665 TGTATTAAAGAGGATAGAAAGGG - Intronic
996132765 5:119801888-119801910 TGTAATGGTGAGGATGGATAAGG - Intergenic
996373127 5:122774573-122774595 TGTATTGGACAGCACAGATAGGG + Intergenic
996662705 5:126022916-126022938 TGTACTGGTTACTATAGATAGGG + Intergenic
997037638 5:130212184-130212206 TGTCTGTGAGAGTATTGATATGG - Intergenic
997221892 5:132175238-132175260 AGTATTGGATAGTGTAGTTATGG + Intergenic
998905739 5:146902770-146902792 TGAATTGGGAAGTATAGATTAGG - Intronic
998973104 5:147614182-147614204 TGTAATGGACAATACAGATAAGG + Intronic
1003675572 6:8201476-8201498 TGGATTGGTTACTATAGATAAGG + Intergenic
1004949713 6:20655290-20655312 TGTAAGGAAGAGTATAGATCAGG + Intronic
1007063662 6:38967262-38967284 TGTATTGGTGGTTCTAGATAGGG + Intronic
1007244801 6:40453245-40453267 AGTATTGGAGAGTGAAGATGTGG + Intronic
1008512804 6:52292412-52292434 TGTCTGGGACAGTATAGAAAAGG + Intergenic
1008527613 6:52421847-52421869 GGTGTTGGTGAGTATAGACAGGG + Intronic
1009050233 6:58266311-58266333 TGTATTTGAGAGTATCTATCAGG + Intergenic
1009339772 6:62540186-62540208 TGTTTTTGAGAGCATATATAAGG + Intergenic
1009495015 6:64335321-64335343 GGAGTTGGGGAGTATAGATAAGG - Intronic
1014849343 6:126322204-126322226 TGTATTGGACAGAGAAGATATGG + Intergenic
1015175685 6:130305428-130305450 TGTTCTGGAGATTATAGACAGGG - Intronic
1015812030 6:137170407-137170429 GGAGTTGGGGAGTATAGATAAGG - Intronic
1016312327 6:142747294-142747316 TGTATTGGAAGGTGTAGATATGG + Intergenic
1018376942 6:163221839-163221861 TGTATTGGAGAGAAGAGCTGAGG + Intronic
1020953657 7:14711942-14711964 TGTATAGGTGAGTATCCATACGG - Intronic
1023227948 7:37991485-37991507 TATGTTAGAAAGTATAGATAAGG - Intronic
1023258642 7:38336493-38336515 TGGAATTGGGAGTATAGATAAGG + Intergenic
1023681977 7:42696468-42696490 TCTATTTAAGGGTATAGATAAGG + Intergenic
1024457085 7:49620938-49620960 TATATTGGAGAGTATAGCAAAGG + Intergenic
1026394641 7:69938913-69938935 TGTATTGGAGAAAAATGATAGGG + Intronic
1026464132 7:70639441-70639463 TTTATTGGTGGGTAAAGATAGGG - Intronic
1027390857 7:77702138-77702160 TGTATTTTTGAGTAGAGATAGGG + Intronic
1028741441 7:94280222-94280244 TGTACTGGACAGCACAGATATGG - Intergenic
1028900153 7:96089695-96089717 TTTTTTGGACACTATAGATATGG + Intronic
1029959766 7:104677686-104677708 TGAACTGGACAGCATAGATACGG - Intronic
1030227147 7:107166204-107166226 TGTATATGTGTGTATAGATATGG + Intergenic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1031960271 7:127983182-127983204 GGTATGGGAAAGTATAGAAATGG + Intronic
1032434560 7:131889471-131889493 TGTATTGGACAGCGTAGACAGGG + Intergenic
1033469944 7:141637469-141637491 TGTATTGGAGAGTATAGATATGG + Intronic
1034675913 7:152892580-152892602 TGTATTGAATAATATAAATATGG - Intergenic
1034760118 7:153664530-153664552 TGGATTTGATATTATAGATATGG + Intergenic
1035943755 8:3934974-3934996 TGTATTACAGAGTTTAGATCTGG - Intronic
1036973125 8:13377600-13377622 TGCACAGGAAAGTATAGATAAGG - Intronic
1039215215 8:35262311-35262333 TGTCTTGGAAACTATAGTTATGG + Intronic
1041473327 8:58235191-58235213 GGAGTTGGGGAGTATAGATAAGG - Intergenic
1043109948 8:76168593-76168615 TGCATTTTAAAGTATAGATATGG + Intergenic
1044184728 8:89237847-89237869 TGGAATTGGGAGTATAGATAAGG - Intergenic
1046142870 8:110118626-110118648 TGTATTTTAGAGTAAAAATAAGG - Intergenic
1048197160 8:132341060-132341082 AATATTGGATAGTAGAGATATGG + Intronic
1048556287 8:135480268-135480290 TGTCTTGGAGAGTCTAGTCAGGG + Intronic
1048779908 8:137989351-137989373 TGGTTTTGGGAGTATAGATAAGG - Intergenic
1049141439 8:140958559-140958581 TGTGTTGGAGAGCATAGTTTTGG - Intronic
1056279502 9:85027563-85027585 CATATTGGACAGTACAGATAGGG - Intergenic
1056874041 9:90310756-90310778 TGTATTCAAAAGTACAGATATGG - Intergenic
1058882856 9:109300475-109300497 TGTATTGAATAATATAAATATGG - Intronic
1061864812 9:133486688-133486710 TGTTAAGGAGATTATAGATATGG - Intergenic
1062306417 9:135909382-135909404 TGTACTGGAGCTTCTAGATAGGG - Intergenic
1186719834 X:12291512-12291534 TGTATTTGGAAGTATAGATAAGG - Intronic
1187877138 X:23813779-23813801 AGAATTAGAGAGTAGAGATATGG - Intergenic
1188131832 X:26445177-26445199 TGTGTTGGAGAATACAGAAAAGG - Intergenic
1189646825 X:43142214-43142236 TGTATAGCAGAGTATAGTTATGG - Intergenic
1192595774 X:72406857-72406879 TGTATTGGACAGTGTAGATATGG + Intronic
1193114207 X:77760196-77760218 TGTATTGGACAGTGCAGATCTGG + Intronic
1195746034 X:108119354-108119376 TGTATTGGACAGTGTAGGTGTGG + Intronic
1196037173 X:111158212-111158234 TGTATTGGTGAATATAGCAAAGG + Intronic
1196487626 X:116232023-116232045 TGTCTTGGGGAGCATAGAAATGG + Intergenic
1196750316 X:119110452-119110474 TGTATGGGAGATTATAGACCGGG + Intronic
1197575647 X:128207935-128207957 TGGAATTGGGAGTATAGATAAGG - Intergenic
1197915730 X:131532515-131532537 TGTACTGGAGATTCTAGACAGGG + Intergenic
1197996109 X:132375853-132375875 CTCATTGCAGAGTATAGATAAGG - Intronic
1198798088 X:140420948-140420970 TGCATTGCAGAGAATATATAGGG - Intergenic
1198912173 X:141626980-141627002 TGTGTGGGAGGGTGTAGATAGGG + Intronic
1199489466 X:148382440-148382462 TGTATTTTAGAGTATAAATGGGG - Intergenic
1200326052 X:155240559-155240581 TGTCTTTGAAAGTATAAATATGG + Intergenic
1201377456 Y:13338842-13338864 GGAGTTGGGGAGTATAGATAAGG - Intronic
1201378530 Y:13347205-13347227 GGAGTTGGGGAGTATAGATAAGG - Intronic
1201630744 Y:16069970-16069992 TGTATTGAACAATATAGAGAGGG + Intergenic
1201640628 Y:16172722-16172744 TGGAATTGAGAGCATAGATAAGG + Intergenic
1201662187 Y:16412604-16412626 TGGAATTGAGAGCATAGATAAGG - Intergenic