ID: 1033470087

View in Genome Browser
Species Human (GRCh38)
Location 7:141639296-141639318
Sequence GACTTTGAAGAGAAGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 459}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033470084_1033470087 -9 Left 1033470084 7:141639282-141639304 CCTTCAAGAAACCTGACTTTGAA 0: 1
1: 0
2: 2
3: 42
4: 331
Right 1033470087 7:141639296-141639318 GACTTTGAAGAGAAGGAGATAGG 0: 1
1: 0
2: 2
3: 43
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033470087 Original CRISPR GACTTTGAAGAGAAGGAGAT AGG Intronic
901104052 1:6741598-6741620 GGCTTTGAAGAGGAGGAGGAGGG - Intergenic
901113001 1:6814300-6814322 GAGGAGGAAGAGAAGGAGATGGG - Intronic
902545138 1:17185285-17185307 GACTTTTATGTGAAGGAGACCGG - Intergenic
904310736 1:29627997-29628019 GACTGTGCAGAGATGCAGATGGG + Intergenic
904677072 1:32205272-32205294 CAGTTTGAAGAGAATGAGAGGGG - Exonic
904904773 1:33887036-33887058 GACTTTGGAGTCAAAGAGATGGG - Intronic
905525846 1:38638933-38638955 TACTTTGAACTAAAGGAGATTGG + Intergenic
906048082 1:42847748-42847770 GACTTTGAAGTGATGGGCATAGG + Intronic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908836620 1:68234648-68234670 TACTTTGAACTGAAGGACATTGG - Intergenic
908840973 1:68279810-68279832 TACTTTGAACTGAAGGACATTGG + Intergenic
908912439 1:69087825-69087847 TACTTTGAACTAAAGGAGATGGG + Intergenic
909070449 1:70986887-70986909 GAGGTAGAAGAGTAGGAGATGGG - Intronic
909994797 1:82266047-82266069 TACTTTGAACTAAAGGAGATTGG - Intergenic
911543753 1:99190593-99190615 GAGTTTGAAGAGAAAGAAAGAGG + Intergenic
912208827 1:107536380-107536402 GACTTTCAAGTGAAGCAGACAGG - Intergenic
912932911 1:113980539-113980561 GAGTTTGATGAGAAGGTGACTGG + Exonic
912941096 1:114045575-114045597 GTTTTTGAGGAGAAGGAGGTAGG + Intergenic
913295974 1:117320851-117320873 TACTTTGAACTAAAGGAGATTGG + Intergenic
913574286 1:120154831-120154853 GACTTTCTAGAGAAGGAGAATGG - Exonic
914295557 1:146319634-146319656 GACTTTCTAGAGAAGGAGAATGG - Intergenic
914436368 1:147663803-147663825 AACATTGAAGACAAGGTGATGGG - Intronic
914556596 1:148770415-148770437 GACTTTCTAGAGAAGGAGAATGG - Intergenic
914616238 1:149359815-149359837 GACTTTCTAGAGAAGGAGAATGG + Intergenic
914736671 1:150424250-150424272 AACTTTGCAGATAAGCAGATTGG + Intronic
914769988 1:150675464-150675486 GGGTTGGGAGAGAAGGAGATGGG - Intronic
915059195 1:153166111-153166133 GACTGGGCAGAGAAGGAGCTAGG - Intergenic
915468826 1:156114023-156114045 GGCTTTGAAGAGAGATAGATTGG + Intronic
915800381 1:158785437-158785459 GGCTTTCAAGAGAAGGATCTAGG - Intergenic
916383719 1:164243549-164243571 GACTCTGAAGGGTAGGAGAATGG + Intergenic
917065935 1:171093274-171093296 GACTTGGAAGGGTAGGAGAGTGG - Intronic
917226334 1:172788044-172788066 CACTCTGAAGAGAAGGACACAGG - Intergenic
917489007 1:175481637-175481659 GACTTGGAAAAGAAGGTGGTGGG + Intronic
917545394 1:175961528-175961550 GACTTTTAACAGAAAGAAATAGG + Intronic
918030171 1:180799961-180799983 GACTTTAAAGACAAAGGGATAGG - Intronic
918858500 1:189790853-189790875 GATTTTGAATAGAGGGATATAGG + Intergenic
919041836 1:192398678-192398700 GACTTTGAGCTGAAGGACATTGG - Intergenic
919572829 1:199270011-199270033 TACTTTGAACTGAAGGAGATTGG + Intergenic
919873980 1:201847736-201847758 GACTAGGCAGAAAAGGAGATTGG + Intronic
920329224 1:205193437-205193459 CACTTTGAACTAAAGGAGATTGG + Intronic
920335877 1:205244819-205244841 GAATGTGGAGAAAAGGAGATGGG + Intronic
921425184 1:214993204-214993226 GAATTTGAGGTGAAGGAAATTGG - Intergenic
922107335 1:222523903-222523925 GACAGTGCAGAGAAGGAGTTAGG + Intronic
922474000 1:225893745-225893767 CACTTTGAAGGGGCGGAGATGGG - Intronic
922787300 1:228289338-228289360 GACTGTGGAGAGGAGGTGATGGG + Intronic
923233917 1:232013983-232014005 TACTTTGAACCAAAGGAGATTGG - Intronic
923262487 1:232280804-232280826 GAGTTTGAAAAGAAAGAGAAAGG + Intergenic
924399991 1:243669142-243669164 GCTTTTGAAAAGAAGGATATGGG - Intronic
924492873 1:244556521-244556543 CACTTTAAATATAAGGAGATAGG + Intronic
1063227870 10:4033374-4033396 GATGCTGAAGAGAAGGAGGTGGG - Intergenic
1063266942 10:4462630-4462652 GATCTTGAGAAGAAGGAGATTGG + Intergenic
1063309836 10:4941705-4941727 GATTTTCCAGAGAAGGAGGTTGG + Intronic
1063317453 10:5020397-5020419 GATTTTCCAGAGAAGGAGGTTGG - Intronic
1064809409 10:19177997-19178019 TACTTTGAACTGAAGGAGATTGG - Intronic
1064891755 10:20182978-20183000 GAATTAGAAGTGAAGTAGATGGG + Intronic
1064992573 10:21268849-21268871 GACTTTGGAAACAAGAAGATAGG + Intergenic
1065207459 10:23370611-23370633 TACTTTGAACTGAAGGATATTGG - Intergenic
1065267433 10:23992401-23992423 GACTTTGAAAAGATGGCAATGGG - Intronic
1065721320 10:28630900-28630922 GGCTTAGAGGAGAAGGACATAGG + Intergenic
1066252973 10:33652087-33652109 GACTTGGAAGAGAAGGGGCAGGG - Intergenic
1067574311 10:47398775-47398797 GAGTGTAAAGAGAAGGAAATTGG + Intergenic
1067821230 10:49532510-49532532 CACTTTGAAAGGAAGAAGATGGG + Intronic
1068458600 10:57294368-57294390 GAGTTTTAAGAGAAGGGGATTGG - Intergenic
1070017178 10:72544728-72544750 GACTTCATAGAGAGGGAGATGGG + Intronic
1070286375 10:75086838-75086860 GACTTTATAGACAAGGAGAGGGG - Intergenic
1070405472 10:76090835-76090857 GGCTGGGAAGAGAAGGAAATGGG + Intronic
1071209239 10:83318229-83318251 TACTCTGAAGGGAAGGACATAGG + Intergenic
1073808911 10:107131292-107131314 GACTTGGAGGAGCAGGAGTTGGG - Intronic
1075008158 10:118845251-118845273 CTCTTTGAAGAGGAGGAGGTGGG + Intergenic
1075221037 10:120584788-120584810 GACTTTGCTGAGAAGCAGCTTGG + Intronic
1075397458 10:122137927-122137949 GACTTTGGACAGAAGGAGGTGGG + Intronic
1075750588 10:124767660-124767682 GACTTGGAAGAGAAACAGTTTGG + Intronic
1075758571 10:124837235-124837257 GAATTTGGAGAAAAGGAGACTGG + Intergenic
1075773940 10:124967277-124967299 CAATTTGAAGAGAAAGAGTTAGG + Intronic
1075921977 10:126221085-126221107 GATTTAGAAGAGAAGGAGGCTGG + Intronic
1075999981 10:126906137-126906159 GACCTTGGAGAGAAGGCGAGCGG + Intronic
1077418544 11:2437252-2437274 GTCTTGGAAGAGGAGGAGGTGGG + Intergenic
1077798961 11:5519069-5519091 AACTATGAAGAGAGGAAGATGGG - Intronic
1078067111 11:8085782-8085804 GTCTCTGAAGAGAGGGAGTTCGG + Intronic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1080862580 11:36162837-36162859 GACTGTCATGAGAAGGGGATGGG - Intronic
1081354229 11:42093171-42093193 GACTTTGAGGAGAACGTTATGGG + Intergenic
1082204907 11:49421415-49421437 TATTTTGAAGTAAAGGAGATTGG - Intergenic
1082635610 11:55589703-55589725 GAGTTTGAAGAAAAGGAATTTGG - Intergenic
1083106702 11:60365243-60365265 GACCTTGAAGAGAATGAGGCTGG + Intronic
1083472696 11:62894798-62894820 GGATTTGGAGAGAAGGGGATGGG + Intergenic
1083575283 11:63786231-63786253 TTCTTTGAAGAGAAGGACAATGG + Intergenic
1084264759 11:67999194-67999216 GGCTTGGAAGACCAGGAGATAGG + Exonic
1085822689 11:79809970-79809992 GACGGTGAAGAGAAGGTGAAAGG + Intergenic
1086490638 11:87354938-87354960 GCCCTTGGAGAGGAGGAGATTGG + Intergenic
1086650187 11:89279112-89279134 TATTTTGAAGTAAAGGAGATTGG + Intronic
1086936816 11:92754323-92754345 GCCTTTAAAAAGAAGGAAATCGG + Intronic
1087902979 11:103663620-103663642 TACTTTGAACAAAAGGAGATTGG + Intergenic
1087915271 11:103802899-103802921 GAATTTGAAGAGATAGAGTTGGG - Intergenic
1088561376 11:111119523-111119545 GACTTTGAGGAGTAGAAGAGGGG - Intergenic
1088915285 11:114222979-114223001 GTCTTGGAGGAGAAAGAGATAGG + Intronic
1089160936 11:116436773-116436795 CACTTAGAAGCGAAGGAGAGAGG - Intergenic
1089369239 11:117942427-117942449 GGCTTTGGAGAAAAGGAGTTTGG - Intergenic
1089843577 11:121440434-121440456 GACTTTGAACTAAAGAAGATGGG + Intergenic
1091071360 11:132567026-132567048 GACTTTTAAAATAAGGATATAGG + Intronic
1092066651 12:5595592-5595614 GACTCTGAAGAGCAGTAGGTAGG - Intronic
1092547053 12:9461299-9461321 GAGGAGGAAGAGAAGGAGATAGG - Intergenic
1093405232 12:18796939-18796961 GACTTTGAAGTGTAGTAGCTGGG - Intergenic
1093464584 12:19436911-19436933 TACTTTGAACTAAAGGAGATTGG + Intronic
1093775461 12:23068584-23068606 CACTTTGCAGAGAAGGAGATTGG + Intergenic
1093823045 12:23645371-23645393 GAGATTGAAGACAAGGAGTTGGG + Intronic
1094427800 12:30333540-30333562 GAATTAGCAGAGAAGGATATTGG + Intergenic
1095168619 12:39006109-39006131 GACTTTGAAGTCAAGGAAAGGGG + Intergenic
1096978291 12:55713103-55713125 GGCCTGGAAGAGAAGGACATGGG - Intronic
1097530137 12:60789571-60789593 GACTTAATAGAGAAGGAAATAGG + Intergenic
1098237515 12:68431722-68431744 TACTCTGCAGAGAAGGAGAGAGG - Intergenic
1098782499 12:74704557-74704579 GACTTTGAACTGAGGGAGATTGG - Intergenic
1100147930 12:91699983-91700005 TACTTTGAACTGAAGGAGGTTGG - Intergenic
1100471155 12:94894362-94894384 GACTTTTGAGATAAGGACATTGG - Intergenic
1100731473 12:97475300-97475322 CACTTTCAAGAGAGGGTGATTGG + Intergenic
1101349035 12:103910977-103910999 GACTTTAAAGAGAAGAAATTAGG - Intergenic
1102414224 12:112746697-112746719 GACCTGGCAGAGAAGGAGACAGG - Intronic
1102617025 12:114163644-114163666 GACCTGGAAGAGGAGGAGCTGGG + Intergenic
1103468056 12:121157654-121157676 GACTTGGAAGAAAAAGAGTTAGG + Intronic
1103636239 12:122308342-122308364 GACTTGGAAGAGAAGGACTTTGG - Intronic
1104716061 12:131017026-131017048 GACTTTGAAGAGCAGGAGTCAGG + Intronic
1105498044 13:20947436-20947458 GCCTTTAAAAAGAAGGAAATCGG - Intergenic
1106246339 13:27953706-27953728 GGCTGTGAAGAGAAGGAGCGGGG + Intergenic
1106448829 13:29861563-29861585 CACTCTGAAGAGAAGAAGCTTGG - Intergenic
1106543732 13:30713184-30713206 GACTTTGAAGAGAGGGTCGTGGG + Intergenic
1107542347 13:41403046-41403068 GACTGTGAAGAGAAGGAAGCTGG - Intergenic
1107664411 13:42674233-42674255 GAAGATGAAGGGAAGGAGATAGG + Intergenic
1107981031 13:45734404-45734426 TACTTTGAAGAAAGGGGGATAGG - Intergenic
1111495595 13:89045172-89045194 GACTTTCAAGATAAGGATTTTGG - Intergenic
1112006605 13:95259015-95259037 GACTCTGGAGAGCAGGAGCTGGG + Intronic
1112111928 13:96310684-96310706 GAGTGGGAAGGGAAGGAGATAGG - Intronic
1113473010 13:110560058-110560080 GACTTTGTACAGAAGCAAATTGG + Intronic
1114541694 14:23465496-23465518 CACTTTGAACTAAAGGAGATTGG + Intergenic
1115423244 14:33222354-33222376 TACTTTGAACTGAAGGAGACTGG - Intronic
1115523588 14:34257406-34257428 TACTTTGAACTGAAGAAGATTGG + Intronic
1116182266 14:41550097-41550119 TACTTTGAACTGAAGAAGATTGG - Intergenic
1116392156 14:44405867-44405889 GACTTAGAAGAAAAAGAGAGAGG - Intergenic
1116478296 14:45366833-45366855 TATTTTGAACTGAAGGAGATTGG + Intergenic
1117053314 14:51884616-51884638 GGCTATGAAGTGAAGGAGACGGG + Intronic
1117604808 14:57417243-57417265 GACTTTTAGGAGAAGGTGTTGGG + Intergenic
1117688832 14:58284080-58284102 GCATTTGAATACAAGGAGATGGG + Intronic
1119003280 14:70902465-70902487 GACATTTAAAAAAAGGAGATTGG + Intergenic
1119307171 14:73616908-73616930 GTTTTTGAAGCCAAGGAGATTGG - Exonic
1119557726 14:75566459-75566481 GACTGTGAAGAGATGGAAACAGG + Intergenic
1120083551 14:80242310-80242332 GATTTGGAAGACAAGTAGATGGG + Intronic
1120280340 14:82430827-82430849 TACTTTGAACTAAAGGAGATGGG + Intergenic
1120662805 14:87270716-87270738 TACTTTGCACTGAAGGAGATGGG + Intergenic
1121646305 14:95519552-95519574 TACTTTGGAGAGAAAAAGATTGG - Intergenic
1121827196 14:97019937-97019959 GACTTTGGAGGGGAGAAGATGGG - Intergenic
1122712843 14:103672682-103672704 CATTTTGAAGATAAGGAAATGGG - Intronic
1125994346 15:44143421-44143443 GACATTGTATATAAGGAGATGGG + Intronic
1126547995 15:49894101-49894123 GACTTGTCAGAGAAGTAGATAGG - Intronic
1127041591 15:54983029-54983051 GCCTTTGAGGAGAAGGAGAGAGG - Intergenic
1127211165 15:56776389-56776411 TACTTTGAACTGAAGGAAATTGG + Intronic
1127251974 15:57248091-57248113 GACTCTCAAAAGAAAGAGATGGG - Intronic
1127311392 15:57754832-57754854 GACTTAGAAGGGAAGGAAACTGG + Intronic
1128041846 15:64581697-64581719 GATTTTTCAGAGCAGGAGATGGG + Intronic
1128530373 15:68441135-68441157 GAATTTGAAGAGCAGAAGATAGG + Intergenic
1128578274 15:68790881-68790903 TACTTTGAACTAAAGGAGATTGG + Intronic
1129677117 15:77637676-77637698 GACTTTAAAGAGAAGGGGTCAGG - Intronic
1131498652 15:92937991-92938013 GATTGTGTAGAGAAGGAGGTAGG + Intronic
1131883455 15:96883573-96883595 GACTTTGAAGGCAGGGAGAGCGG - Intergenic
1132184701 15:99792790-99792812 ATCTTTGGAGAGAAGGAGGTGGG - Intergenic
1132349898 15:101133181-101133203 GAGTTTGAGGAGAAGGTGCTTGG - Intergenic
1132432282 15:101771864-101771886 ATCTTTGGAGAGAAGGAGGTGGG + Intergenic
1133793820 16:9030344-9030366 GACTTGGAAGAGGAGGGAATGGG - Intergenic
1137554676 16:49463111-49463133 GACAGAGAAGAGAAGGAGAAAGG - Intergenic
1138726919 16:59150285-59150307 GACTTTGCAGAGAAATAGATAGG - Intergenic
1139514887 16:67447066-67447088 GACGTTGAAAAAGAGGAGATTGG - Intronic
1140858279 16:78997093-78997115 TACATTGAAGAGCAGAAGATTGG - Intronic
1141966592 16:87449327-87449349 AACTCTGAAGAGAAGTAGAAAGG + Intronic
1143792518 17:9308827-9308849 TACTTTGAACTGAAGGACATTGG - Intronic
1144081623 17:11768756-11768778 GACTTTGCAGAGGAGATGATGGG + Intronic
1144430352 17:15185577-15185599 GACCTTGCAAAGAAGGGGATGGG - Intergenic
1147395103 17:40136412-40136434 GACTTTGTTGAGAAGGAGGTTGG + Intronic
1148238713 17:45986023-45986045 GACTGTCAAGAGAAGGAGAAGGG + Intronic
1148339405 17:46864343-46864365 GTATGTGAAGAGAAGGAGTTGGG - Intronic
1148935503 17:51161756-51161778 GAGAGTGCAGAGAAGGAGATCGG + Exonic
1150043870 17:61892028-61892050 GAATTTGGAGAGAGAGAGATAGG + Intronic
1150293497 17:63995424-63995446 GACATTGAAGAAAATGAGTTTGG - Intergenic
1150875784 17:68968800-68968822 GGCTTTCTAAAGAAGGAGATGGG - Intergenic
1151055846 17:71030817-71030839 AACTTTGAACTGAAGGACATTGG + Intergenic
1151143397 17:72016730-72016752 GACTTTGAGGAGATGGGGAGTGG - Intergenic
1153367840 18:4278438-4278460 GACTGGGAAGAGTAGGAGAGTGG - Intronic
1155025237 18:21934953-21934975 GCCTTTGAGGAGGAGGACATGGG - Intergenic
1155445215 18:25904250-25904272 CAGGTTGAAGATAAGGAGATAGG + Intergenic
1155445262 18:25904836-25904858 CAGGTTGAAGATAAGGAGATAGG - Intergenic
1155940498 18:31797703-31797725 TACTTTGAACTAAAGGAGATTGG - Intergenic
1157843525 18:50981097-50981119 GACTTGGAAGAGTAGGAGGGTGG - Intronic
1157983002 18:52404079-52404101 GACTTTGAGGGGTAGGAGGTGGG + Intronic
1158321446 18:56268536-56268558 TTCTTTGAAGAGATGGAGCTGGG - Intergenic
1158337039 18:56423530-56423552 TATTTTGAAGAGAATGAGACTGG + Intergenic
1158491714 18:57916226-57916248 GGCTTTGCAGAGAAGGGGAGTGG + Intergenic
1158557909 18:58490455-58490477 GACTTTGTTCAGAGGGAGATGGG - Intronic
1158575181 18:58631168-58631190 GACGTTGAAGAGAAAAAGAAAGG + Intergenic
1158886071 18:61828801-61828823 GAATCTGAAGAGAAAAAGATAGG + Intronic
1158891359 18:61875121-61875143 GAGTTTGAATAGAAGGATAGAGG + Intronic
1159279688 18:66269630-66269652 AACTTTGAAAATAAGAAGATAGG + Intergenic
1162122256 19:8478428-8478450 GACTTTGCCAGGAAGGAGATGGG + Intronic
1164441642 19:28284255-28284277 GACTTTGGGAAGAAGGAGTTTGG - Intergenic
1164848848 19:31462164-31462186 CACATGGAAGACAAGGAGATTGG + Intergenic
1164951488 19:32340715-32340737 GACGATGAAGAGGAGGAGAAAGG - Intergenic
1165263081 19:34637252-34637274 GGCCTTGCAGGGAAGGAGATGGG - Intronic
926091570 2:10054222-10054244 GATTTTGATGAGCAGGAGAAAGG - Exonic
926276135 2:11404604-11404626 GACTTTGCAGAAAAGGACAGTGG - Intergenic
926335494 2:11859585-11859607 GACTTGGAAGAGGAAGAAATTGG + Intergenic
926705551 2:15834904-15834926 GACTGGGAAGAGCAGTAGATGGG - Intergenic
927220634 2:20705297-20705319 GAGTTTGAGGATAAGGAGATGGG - Intronic
927739862 2:25559216-25559238 GACTATGAAGACAAGGAGAAGGG - Intronic
928211985 2:29330170-29330192 GACCTTGAAGAGCAGGTGAAAGG - Intronic
928219986 2:29395520-29395542 GACTTTAAACTGAAGGACATTGG + Intronic
929187647 2:39112058-39112080 GAGTTAGAAGAGAAGGATAGTGG - Intronic
929461406 2:42104325-42104347 TACTTTGAACTAAAGGAGATTGG - Intergenic
929684457 2:44022162-44022184 GCCTTTGAAAAGAAGGTAATGGG + Intergenic
929867546 2:45731011-45731033 AATTTTGAAGTGAAGGAAATAGG + Intronic
930116591 2:47723410-47723432 GACTTTAACCAGAAGGTGATGGG - Intronic
930595546 2:53383479-53383501 GACAGAGAAGAGAAGGAGACAGG + Intergenic
930783217 2:55244612-55244634 GTCTTTAAAAAGAAGGAAATTGG + Intronic
930920521 2:56748001-56748023 CACTTTGGAGAGAAGAAAATGGG - Intergenic
931331923 2:61295796-61295818 GACTTGGAAGTGAAGAAGATGGG - Intronic
931657006 2:64518425-64518447 GACTTTGAAGTGAAAGTGGTGGG + Intergenic
931994185 2:67824038-67824060 GATTTTGAGTAGAAGGAAATAGG - Intergenic
932185273 2:69689866-69689888 GACTTTGTTGGGAAGTAGATAGG - Intronic
932659646 2:73641270-73641292 GAGTCTGAAGAGAAGGTGGTGGG - Exonic
932666209 2:73700947-73700969 GAATCTGAAGAGAAGGTGGTGGG - Intergenic
933258947 2:80110414-80110436 GACTTTGAAATGAGGAAGATTGG - Intronic
933357781 2:81235072-81235094 ACCTTTGGAGAGAAGGAGAAGGG + Intergenic
934989386 2:98910799-98910821 CACTTTGCAGAAAAGGAAATGGG - Intronic
936838225 2:116734549-116734571 GATTTTGAAAAGAAGAAGATAGG + Intergenic
936918326 2:117662440-117662462 CACTGAGAAGAGAAGGAGAGAGG - Intergenic
938937261 2:136137972-136137994 TACTTTGAACTAAAGGAGATTGG - Intergenic
938942159 2:136178826-136178848 TACTTTGAACTGAAGGAAATTGG - Intergenic
939013312 2:136872708-136872730 GTTTTAGAAGAAAAGGAGATTGG + Intronic
939827684 2:147034939-147034961 GGCTTTCTAGAGAAGCAGATTGG + Intergenic
940137392 2:150453936-150453958 TACTTTAAAGAGAAGGTGTTAGG - Intergenic
941457092 2:165721983-165722005 TACTCTGAAGAGCAGGAGGTGGG - Intergenic
942207651 2:173636995-173637017 GGCTTGGAAGAGTAGGAGAAAGG + Intergenic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
942642572 2:178075194-178075216 GACTTGGAAGGAAAGAAGATTGG + Intronic
943083830 2:183288305-183288327 TACTTTGAACTGAAGGAGATGGG + Intergenic
944548073 2:200817890-200817912 AACTATGAAGGGAAGGATATAGG + Intronic
945488738 2:210429366-210429388 GAGTGTGAAGAGGAGGAGAAAGG + Intergenic
945777598 2:214126364-214126386 TACTTTGAAATGAAGGAAATTGG - Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
947292348 2:228590154-228590176 GACTTTGGAGAGGTGGAGAAGGG - Intergenic
947768501 2:232652869-232652891 CACTTTGAAGAGAGAAAGATAGG + Intronic
947919959 2:233861650-233861672 GATTTTGAGGAGAAAGACATTGG + Intergenic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169648651 20:7842602-7842624 TACTTTGAAATGGAGGAGATAGG + Intergenic
1169678611 20:8183173-8183195 ATCCTTGTAGAGAAGGAGATTGG + Intronic
1169994045 20:11536602-11536624 GAATTTGAAGAGAAGGAATTAGG - Intergenic
1170315741 20:15039506-15039528 TACTTTGAAGTAAAGGAGACTGG - Intronic
1170587202 20:17743773-17743795 GACTCTGAGAAGAAGGAGGTAGG + Intergenic
1170959577 20:21013185-21013207 CACATTGAAGAAAAGGTGATGGG - Intergenic
1172026631 20:31953143-31953165 GGCTTTGAAAAGAAGGTGAGGGG + Intergenic
1172353201 20:34260134-34260156 GACAAGGAACAGAAGGAGATTGG - Intronic
1172468708 20:35175455-35175477 GTCTTTGAGAAGAAGGAGTTAGG - Intronic
1172824718 20:37771585-37771607 ACCTTTGCAGAGCAGGAGATAGG - Intronic
1173257357 20:41404290-41404312 AACTTGGAAGAGAAGGGGGTAGG + Exonic
1173338213 20:42130453-42130475 GAGATTGGAGAGAAGGAGAAAGG - Intronic
1173860136 20:46277864-46277886 GGCTTTGAAGGGAAGGAGGGAGG + Intronic
1174209989 20:48870341-48870363 GGCTTTGAAGAGTTGGAGTTGGG - Intergenic
1174522043 20:51139115-51139137 GACTTTGCCCAGAAGGTGATAGG - Intergenic
1174656567 20:52176864-52176886 GACTTTGTTTAGAAGGATATAGG - Intronic
1174741331 20:53016983-53017005 GACTTGGAGGAGAAGGAGAATGG + Intronic
1175276912 20:57777729-57777751 GCCTTTAAAAAGAAGGAAATTGG - Intergenic
1177172605 21:17670709-17670731 TACTTTGAACTGAAAGAGATAGG + Intergenic
1177895103 21:26847289-26847311 GAAGTCGAAGAGAAGGAGGTAGG - Intergenic
1177979187 21:27889412-27889434 TACTTTGAACTAAAGGAGATTGG + Intergenic
1178041617 21:28646197-28646219 GACTATGAAGAGAAAGAGGGAGG + Intergenic
1178458847 21:32782316-32782338 TACTTTGAACTAAAGGAGATTGG - Intergenic
1178776828 21:35559482-35559504 GACTTTGAAAAGATGGGAATTGG + Intronic
1179117107 21:38503554-38503576 GAATTTGAGGAGACTGAGATAGG - Intronic
1179565585 21:42245871-42245893 GACTCTGATGAGGAGGAGACAGG + Intronic
1179587684 21:42383896-42383918 GACTCTGAGGGCAAGGAGATAGG + Intronic
1180604666 22:17048421-17048443 GAATTTGAGGAGAATGAGACTGG + Intergenic
1181182063 22:21075356-21075378 GACCTTGAAGAGAATGAGCCAGG - Intergenic
1181671321 22:24426846-24426868 GACTTGGAGGAGAAGGTGAAGGG - Intronic
1183583341 22:38738456-38738478 GATTTGGAAGAGGAGGAGCTAGG - Intronic
1183699733 22:39444538-39444560 GAGTTTGAGGAATAGGAGATGGG + Intergenic
1184022140 22:41827916-41827938 GACTTAGCAGAGAAGGTGCTTGG + Intergenic
1184482511 22:44756127-44756149 GACTTTGCAGGGGAGGAGAGTGG + Intronic
950606898 3:14089751-14089773 GACGTGGAAGAGAAGGAGGATGG + Intergenic
951348225 3:21572485-21572507 TACTTTAAAGTGAAGGACATAGG + Intronic
951639239 3:24816361-24816383 TACTTTGAACTGAAGGAGATTGG + Intergenic
952413674 3:33071627-33071649 TACTTTGAACTAAAGGAGATCGG + Intronic
953422612 3:42766098-42766120 AACTATGCAGAGAAGGAGAGGGG + Intronic
954653224 3:52177970-52177992 GGCTTTTAAGAGAAGCAGAGCGG + Intergenic
955861561 3:63335708-63335730 GCCTTTAAAGACTAGGAGATAGG - Intronic
957262538 3:77920395-77920417 GACTCTGAAGAGAAAGTGCTTGG + Intergenic
957288989 3:78252676-78252698 CACTTTGAACATAAGGACATAGG + Intergenic
957501862 3:81067549-81067571 CACTTTCCAGAGAAGGAGAATGG - Intergenic
957647147 3:82945667-82945689 GAATTTGAAGAAAAGGAAAATGG - Intergenic
958005194 3:87801702-87801724 GACTTTGAATAGAATGGGAGGGG + Intergenic
958991219 3:100847994-100848016 GATTTGGAAGAAAAGGAGAAGGG - Intronic
959820429 3:110729239-110729261 GAGTTGGAAGAAAATGAGATAGG - Intergenic
960006082 3:112782613-112782635 TACTTTGAACTGAAGGAGATTGG + Intronic
960243373 3:115372238-115372260 GTCTTTGTAGAGCAGGAAATGGG - Intergenic
960869339 3:122233255-122233277 GACATAGCAGAGAAGGAGAACGG - Intronic
960883236 3:122367157-122367179 GAGGGTGAAGAGAAGGAGAGAGG + Intronic
961052703 3:123760549-123760571 GACTTTGAAGAAAAGAAGAGAGG - Intronic
961141953 3:124563223-124563245 GACTGTGAAGAGAATGGGTTGGG + Intronic
961556859 3:127701852-127701874 GGCTTTGAAGAGAAGGAACAGGG - Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
963159123 3:142132294-142132316 GGCTGGGAAGAGAAGGGGATGGG + Intronic
963207431 3:142651156-142651178 TACTTTTAAGAGATGGAGACAGG + Intronic
963573186 3:147023701-147023723 GACTGGGAAGAGAAGGGGAAAGG + Intergenic
965539915 3:169861633-169861655 GACTTTGCATAGAGGAAGATAGG - Intronic
967247127 3:187499331-187499353 GACTTTCAAGAGGAAGAGGTGGG - Intergenic
967404662 3:189102045-189102067 GACTTTTAAGAGATAGAGAGAGG - Intronic
968222241 3:196947772-196947794 GAAGTAGAGGAGAAGGAGATAGG + Exonic
968382709 4:109285-109307 GACTATGGAGAAAAAGAGATTGG - Intergenic
969287774 4:6216289-6216311 GACTTAAAAGTTAAGGAGATAGG + Intergenic
970126230 4:12815125-12815147 GACCTTGAAGAGAAGATGACAGG + Intergenic
970301780 4:14688903-14688925 GACTTTGAATATAAAGAGATAGG - Intergenic
971034329 4:22676698-22676720 TACTTTGAACTGAAGTAGATTGG + Intergenic
972004186 4:34077911-34077933 GCCTTATAAGTGAAGGAGATGGG + Intergenic
972540228 4:40032596-40032618 TATTTTGTAGAGAAGGAGCTTGG + Intergenic
972602556 4:40585981-40586003 TACTTTATAGAGAAGGAGCTTGG - Intronic
972822032 4:42713030-42713052 GACTTTCAAAAGAAGGGGAAAGG + Intergenic
973096671 4:46210505-46210527 GACTGGAAAGGGAAGGAGATGGG + Intergenic
973792872 4:54394680-54394702 GACTCCGGAGAGAAGGGGATGGG - Intergenic
973987920 4:56373569-56373591 TACTTTGAACTGAAGGACATTGG - Intronic
974334176 4:60518617-60518639 GACTTTGGAGAAAAGAAGAAAGG + Intergenic
975147332 4:70982924-70982946 TACTTTGAAGAGAAGGGGATAGG + Intronic
975738198 4:77402512-77402534 AACTTTGCAGAGATGGGGATAGG + Intronic
976451786 4:85199200-85199222 TACCTTGAAGAGAAGGATATAGG - Intergenic
976550798 4:86392870-86392892 GACTTTGGGGAGATGGAGAGAGG + Intronic
976761419 4:88553490-88553512 GACTTTTAAAAGAATGACATGGG + Intronic
977047553 4:92087035-92087057 TGCTTTGAAGAGAAAGAGATAGG + Intergenic
978227361 4:106353223-106353245 TACTTTGAACTGAAGGAGATTGG - Intergenic
978298781 4:107240965-107240987 GACTTTGGAGAGAAAGAGAGCGG + Intronic
978766090 4:112406495-112406517 TAGTTTGAAGTAAAGGAGATTGG + Intronic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
979841438 4:125446524-125446546 TACCTGGAAGAGTAGGAGATGGG - Exonic
982121053 4:152144290-152144312 TACTTTGAACTGAAGGAGGTTGG + Intergenic
982572777 4:157071551-157071573 GACTTGGAAGAGGAAGAGATAGG - Intergenic
982680833 4:158427330-158427352 GAATATGAATAGAAGGAGAATGG - Intronic
982957319 4:161788394-161788416 GGCTTGGAAGGGAGGGAGATGGG - Intronic
983194928 4:164796626-164796648 AACTTTGAAGGGAAGGTGGTGGG - Intergenic
983518367 4:168679836-168679858 GAATTTGAGAAGGAGGAGATGGG + Intronic
984727635 4:183036678-183036700 TACTTTGAACTGGAGGAGATTGG + Intergenic
984809405 4:183781624-183781646 GAGTTGGAAGAGAAGGAGAAAGG - Intergenic
984892965 4:184509701-184509723 GACTATGAATAGCAGGAGATGGG - Intergenic
985805604 5:2040378-2040400 GACTTGGGCAAGAAGGAGATGGG - Intergenic
986520824 5:8616342-8616364 GACTGACAAGAGAAGCAGATAGG - Intergenic
986676250 5:10188307-10188329 AACTTTGAACTGAAGGAGATTGG - Intergenic
986875658 5:12105471-12105493 CACTCTGAAGAGAAGATGATAGG + Intergenic
986922269 5:12700689-12700711 TAATTTGAAGAGAGGGAGAGAGG - Intergenic
988365988 5:30299850-30299872 AGCTTTGGAGAGAAAGAGATAGG + Intergenic
988867093 5:35347347-35347369 GATTTTAAATAGCAGGAGATAGG - Intergenic
988884125 5:35536347-35536369 GACTCAGAAGAGAAGCACATTGG + Intergenic
989208892 5:38840515-38840537 TACTTTGGAGAGAATTAGATGGG - Intergenic
990628582 5:57641986-57642008 GACCTTGTAGAGAAGGAGCATGG + Intergenic
992816422 5:80444939-80444961 CACTCTGAAGAGGAGTAGATAGG - Intronic
993034089 5:82737770-82737792 TGCTTTGAACTGAAGGAGATTGG - Intergenic
993185081 5:84607164-84607186 GAGTTTGTGGAGAAGGAGAAAGG + Intergenic
994170421 5:96653516-96653538 TATTTTACAGAGAAGGAGATGGG - Intronic
994226391 5:97255764-97255786 GAGTATATAGAGAAGGAGATGGG + Intergenic
994862586 5:105217290-105217312 GTCTTTGAATAGAATGAGAGTGG - Intergenic
995067090 5:107874708-107874730 GGGTTGGAAGAGGAGGAGATGGG + Intronic
995909854 5:117173584-117173606 GGCTGTGAAGGGAAGGAAATAGG + Intergenic
996505125 5:124259916-124259938 TACTTTGAACTAAAGGAGATTGG - Intergenic
997167378 5:131675719-131675741 GAAGTTGGGGAGAAGGAGATGGG + Intronic
997750760 5:136343315-136343337 CACTTTGAACTGAAGGAGATTGG + Intronic
998163640 5:139827974-139827996 GAGGTGGAAGAGCAGGAGATGGG + Intronic
998664821 5:144284805-144284827 AATTTGGAAGAAAAGGAGATTGG + Intronic
998806109 5:145919160-145919182 GACTTTGGACTGAAGGAGAAAGG - Intergenic
999363981 5:151009336-151009358 GTATTTGAAGAGAAACAGATTGG + Intergenic
999825443 5:155269187-155269209 TACTTTGAAGTGAAGGACATTGG - Intergenic
1000197209 5:158971382-158971404 GACCTTGAAGAAAAGCAAATGGG + Intronic
1000500103 5:162037206-162037228 GAACATGGAGAGAAGGAGATGGG + Intergenic
1001191915 5:169639170-169639192 GACTTAGAATAGAAGGAAAATGG + Intronic
1002501972 5:179652510-179652532 GGATTGGGAGAGAAGGAGATGGG + Intergenic
1002799296 6:505757-505779 GGCTATGATGAGAAGGAGAATGG - Intronic
1004347028 6:14857904-14857926 GACTGAGGAGAGAAGGAGAAAGG - Intergenic
1005099688 6:22157399-22157421 CATTTTGCAGATAAGGAGATTGG + Intergenic
1006090624 6:31626656-31626678 GACTTCGGAGGGAAGGATATTGG + Intronic
1006712034 6:36082791-36082813 AACTGTGAACAGAAGGTGATAGG - Intronic
1006712917 6:36090962-36090984 AACTTGGAAGATAAGGAGCTAGG + Intronic
1006784665 6:36658053-36658075 GAGTTTGAAGAGCAGGACAGAGG - Intergenic
1007085238 6:39139744-39139766 GTCTTTGAACAGAGGGAAATAGG + Intergenic
1007596050 6:43052059-43052081 GAGTTGGAAGAAAAGGAGGTGGG - Intronic
1008342538 6:50384927-50384949 GATTTGAAAGAGAAGGAAATGGG + Intergenic
1009498575 6:64382238-64382260 GAGAGTGAAGAGAATGAGATAGG - Intronic
1009890708 6:69677571-69677593 TACTTTGAACTGAAGGATATTGG - Intronic
1010246528 6:73664458-73664480 TACTTTGAACTAAAGGAGATTGG - Intergenic
1010483495 6:76382148-76382170 CACTCTGAAGGGAAGGACATAGG - Intergenic
1010708901 6:79149091-79149113 CACTTTGAAGAGAGGGCCATTGG - Intergenic
1010744593 6:79546642-79546664 TGCTTTGAAGAAGAGGAGATTGG + Intergenic
1010952682 6:82055877-82055899 GAGTAAGAATAGAAGGAGATAGG + Intergenic
1011489307 6:87874310-87874332 TACTTTGAACTGAAGGAGGTGGG - Intergenic
1011791605 6:90904943-90904965 GACCTTTCAGAGAAGGAGAAGGG + Intergenic
1013891081 6:115027863-115027885 GTCTGTAAAGGGAAGGAGATAGG - Intergenic
1014071664 6:117188459-117188481 CTTGTTGAAGAGAAGGAGATAGG + Intergenic
1016414542 6:143819323-143819345 GACTGTGAAGAAAAGGTAATAGG + Intronic
1016505486 6:144773998-144774020 TACTTTGAAATGAAGGAGACTGG - Intronic
1016623995 6:146144786-146144808 GGCTTAGAAGACAAGAAGATGGG + Intronic
1016986573 6:149900067-149900089 GCCTTTGAAGATGAGGAAATGGG - Intergenic
1017317462 6:153048384-153048406 GAATTGTAATAGAAGGAGATAGG - Intronic
1017464962 6:154686276-154686298 GACTTAGAAGAGTAGGAGTTTGG + Intergenic
1017684096 6:156894510-156894532 GACATGGAAGATAAGGAGAAAGG + Intronic
1018377347 6:163225876-163225898 GCCTTTAAAAAGAAGGAAATTGG + Intronic
1019832762 7:3349529-3349551 GACTAAGAAGCGAAGGATATGGG + Intronic
1019867499 7:3726120-3726142 GACTTTATAGAGAAGGATCTAGG + Intronic
1020654274 7:10911098-10911120 GGCATTTAAGAGAAGGAGGTTGG - Intergenic
1020857125 7:13443056-13443078 GTGTTAGAAGAGAAGGAGCTTGG - Intergenic
1021338133 7:19429634-19429656 GACTTGGAAGAGTAGGAGGGTGG + Intergenic
1021342693 7:19484520-19484542 AACTTTGAAAAGAAAGGGATAGG + Intergenic
1021575095 7:22099394-22099416 GACTTTGCAGCAAAGGAGGTGGG - Intergenic
1021579117 7:22133535-22133557 GACTTTGAAGAGATGGCAAGTGG + Intronic
1022925575 7:35052956-35052978 TACTTTGAATAAAACGAGATTGG + Intergenic
1023128680 7:36980202-36980224 GACTTTGAAAAGAAGCATACAGG - Intronic
1023351508 7:39324363-39324385 GAGTTTCAAGAGAAAGTGATGGG + Intronic
1024607520 7:51034562-51034584 CCCTTTGGAGAGAAGTAGATGGG - Intronic
1024720925 7:52136932-52136954 GACTATGAAGAGGAGGAGGAGGG + Intergenic
1025170666 7:56753769-56753791 GAGTTGGAAGAGATGCAGATTGG + Intergenic
1027498396 7:78917435-78917457 GACTGTGAAGAGGAATAGATGGG + Intronic
1027693758 7:81382127-81382149 TACTTTGAACTGAAGGTGATTGG - Intergenic
1027768590 7:82377733-82377755 GACCAGGAAGAGAAAGAGATTGG - Intronic
1028368904 7:90068690-90068712 GACACTGAAGAGAAGGAAATAGG + Intergenic
1028862812 7:95672625-95672647 GAATTTGAATAGAAGGAAACAGG + Intergenic
1029823581 7:103167653-103167675 TACTTTGAATAAAATGAGATTGG + Intergenic
1030938944 7:115620840-115620862 TACTTTGAACTGAAGGATATTGG + Intergenic
1031207286 7:118776813-118776835 GAATTTGAAAAGGAGGAGACAGG - Intergenic
1031877279 7:127156091-127156113 AACTCTGAGGAGAAAGAGATTGG + Intronic
1032177605 7:129644854-129644876 TAATTTGAATAGAAGAAGATTGG + Intronic
1032693499 7:134313302-134313324 AACTTTGAAGAGAATGAATTGGG + Intronic
1032716405 7:134512641-134512663 CACTTTGAAAAAAAGGAAATTGG - Intergenic
1032798600 7:135299639-135299661 CACTTTGAAGAAAAGCAAATAGG + Intergenic
1033470087 7:141639296-141639318 GACTTTGAAGAGAAGGAGATAGG + Intronic
1037672605 8:21028220-21028242 GTTCTTGAAGTGAAGGAGATGGG - Intergenic
1037862594 8:22416359-22416381 CACTGTGAAGACAGGGAGATGGG - Intronic
1038498686 8:28025328-28025350 GATGGTGAAGAGAAGGAAATAGG + Intronic
1038805201 8:30784098-30784120 GTCTTTAAAAAGAAAGAGATGGG - Intronic
1039735495 8:40328074-40328096 GGCTGTGAAGAGTAGGAGAGAGG + Intergenic
1040389783 8:46939980-46940002 GACTTGGAGGAGTGGGAGATGGG + Intergenic
1040854296 8:51932747-51932769 GATCTTGAAGATAAAGAGATTGG - Intergenic
1041147682 8:54895156-54895178 GACTTTGAACTGAAGGACGTTGG + Intergenic
1041409523 8:57537637-57537659 GTCTTTGAAAAGAATGAGACAGG - Intergenic
1041716646 8:60938529-60938551 GAAAATGAAGAGGAGGAGATTGG - Intergenic
1041807540 8:61869246-61869268 GATTTTGAAGTTCAGGAGATTGG + Intergenic
1041897763 8:62946065-62946087 GAAATTGAAGAGAAGCACATGGG - Intronic
1042281203 8:67058298-67058320 GTAATTGAGGAGAAGGAGATGGG - Intronic
1042425745 8:68645907-68645929 TACTTTGAACTGAAGGAGACTGG + Intronic
1042443315 8:68852984-68853006 TACTTTGAACTAAAGGAGATTGG - Intergenic
1042518767 8:69688191-69688213 GACTATAAATAGAAGGAGCTAGG + Intronic
1042714528 8:71758270-71758292 GACTTAGAAAAGAAGCACATAGG + Intergenic
1046108497 8:109693249-109693271 GACTTTGAATAGAGGTAGAAGGG - Intergenic
1046820964 8:118633931-118633953 GACTTGGAAGGGAAGGGGATGGG - Intergenic
1047010344 8:120665842-120665864 GACTTTCAAGAGAAGTACAAAGG - Intronic
1048082780 8:131147411-131147433 GATTTTGAAGAGGTGGACATGGG + Intergenic
1049529502 8:143147331-143147353 GAGTTTGGAGAGAAGGAGGATGG + Intergenic
1049994919 9:1025638-1025660 GATTTTGAAGAAGAGGAGGTAGG + Intergenic
1050258567 9:3817668-3817690 GGGTTTGAAGAGAAGGGGTTTGG - Intergenic
1050959892 9:11715931-11715953 GTCTTGCAAGAGAAGGGGATGGG + Intergenic
1052380076 9:27760612-27760634 GACTTGGAAAAAAAGGAGCTAGG - Intergenic
1052666150 9:31497533-31497555 GGCTCAGAAGAGAAGAAGATAGG - Intergenic
1052798044 9:32942076-32942098 AACTTTGACGAGCAGGAGAAAGG - Intergenic
1053316453 9:37055983-37056005 GACTTGAAGGAGAAGGAGCTGGG - Intergenic
1053851423 9:42291593-42291615 TACTTTGAACTAAAGGAGATTGG - Intergenic
1055115040 9:72597103-72597125 GACTTTTTAGATGAGGAGATAGG + Intronic
1056047210 9:82731424-82731446 GACTCTGAAGGGTAGGAGACTGG - Intergenic
1056136855 9:83638358-83638380 GAATTAGAAGAAAAGCAGATTGG + Intronic
1056240646 9:84643110-84643132 CATTTTGAAGGGAAGGTGATGGG + Intergenic
1056775623 9:89510401-89510423 GAATTAGAAGAGAAAGTGATGGG - Intergenic
1058582151 9:106470189-106470211 TACTTTGCAGATAAGGAAATTGG + Intergenic
1058969195 9:110064587-110064609 TGATTTGAAGAGAAGGATATGGG + Intronic
1059387209 9:113973926-113973948 GATCTTGTAGACAAGGAGATTGG + Intronic
1059569103 9:115415316-115415338 CACTGTTAAGAGAAGGAAATTGG - Intergenic
1059757184 9:117304542-117304564 GACTTTGATTAGAAGGAGGAGGG - Intronic
1061072813 9:128322249-128322271 GACTTCCAAGAGAACGAGAGCGG + Intronic
1062357403 9:136171318-136171340 GGCTCTGAAGAAAAGGAGGTGGG - Intergenic
1062682569 9:137789664-137789686 GACTTTGACCGGAAGGAGCTGGG - Intronic
1187692911 X:21889332-21889354 AAGTTAGAACAGAAGGAGATAGG + Intergenic
1187717042 X:22113117-22113139 TACTGTGAAGAGAATGAGAGAGG + Intronic
1187765663 X:22638788-22638810 GATTTTCAAGAGAACAAGATGGG + Intergenic
1188370009 X:29358251-29358273 TACTTTGAACCAAAGGAGATTGG - Intronic
1188398473 X:29715666-29715688 TACTTTCAGGAGAAGGAGAGTGG - Intronic
1188482532 X:30650272-30650294 GACTGGGAAGAGAAGGACATTGG - Intergenic
1188894026 X:35644154-35644176 TAATTTGAAGAAAAGGAGGTTGG - Intergenic
1189185144 X:39048580-39048602 GAATGGGAAGAGAAGGAGAGTGG - Intergenic
1189606365 X:42682255-42682277 TACTTTGAACTAAAGGAGATTGG - Intergenic
1190787775 X:53668907-53668929 TACTTTGATGACAATGAGATTGG + Intronic
1191860992 X:65666823-65666845 GACCTTGACAAGAAGGAGAAAGG + Intronic
1192024768 X:67437827-67437849 AGCTGTGAAGAGAAGGAGAGAGG - Intergenic
1192346866 X:70317245-70317267 GAGTCTAAAGGGAAGGAGATAGG - Intronic
1192676890 X:73206369-73206391 GATTTTAAAGAGAAGTAGTTAGG - Intergenic
1193888683 X:87016098-87016120 GACTTGGAAGAGAAGGAAAGAGG + Intergenic
1194246975 X:91526152-91526174 GATTTTCATGAGAAGGAGACAGG - Intergenic
1194973087 X:100365738-100365760 TATTTTGAAGATAAGGAAATGGG + Intronic
1195645953 X:107230753-107230775 TACTTTTAAGATAAGGAGTTTGG - Intronic
1195681742 X:107552407-107552429 GACTTATAAGAGAAGGTGAAGGG + Intronic
1195752196 X:108170417-108170439 GAGTGTGAAGAGAAGAATATGGG - Intronic
1196197629 X:112852697-112852719 ACCTTGGAAGAGAAGGTGATAGG - Intergenic
1196245626 X:113396043-113396065 AACTTTGAACTGAAGGGGATTGG + Intergenic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic
1197101700 X:122663547-122663569 TACTTTGAACTAAAGGAGATTGG - Intergenic
1198124711 X:133631251-133631273 GACTATGGGGAGAAGGAAATAGG - Intronic
1198541423 X:137644131-137644153 AACTCAGAAGGGAAGGAGATGGG - Intergenic
1199064330 X:143396643-143396665 GGCTTTGCAGAGAATGAGAAAGG - Intergenic
1199437941 X:147834761-147834783 GAATTTGAAAATAAAGAGATAGG - Intergenic
1200565940 Y:4767440-4767462 GATTTTCATGAGAAGGAGACAGG - Intergenic
1201650926 Y:16284908-16284930 TCCTTTTAAGAAAAGGAGATTGG - Intergenic