ID: 1033471100

View in Genome Browser
Species Human (GRCh38)
Location 7:141649905-141649927
Sequence CTGTATTGGAAAAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 464}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033471100 Original CRISPR CTGTATTGGAAAAGGGAAAA AGG (reversed) Intronic
900920271 1:5665686-5665708 AGGTATTTGAAAAGGAAAAAGGG - Intergenic
901575108 1:10194338-10194360 CAGTAATGGAAAAGTAAAAAGGG + Intergenic
906332140 1:44895026-44895048 ATATATTGGAAAAAGTAAAAAGG - Intronic
907089176 1:51708899-51708921 ATAGATTGGAAAAGGGAAAATGG - Intronic
908116095 1:60941736-60941758 TTGACCTGGAAAAGGGAAAATGG - Intronic
908269697 1:62410952-62410974 CTGTCTTTGAAAATGGAGAAAGG - Intergenic
909128145 1:71701400-71701422 CTGGTTTGGAAAATGGAGAAAGG - Intronic
909667433 1:78150824-78150846 CTGAATTGAAAAAGAAAAAAAGG - Intergenic
909913406 1:81288715-81288737 CTGTGTTGCAAGTGGGAAAATGG - Intergenic
910509233 1:87985101-87985123 ATGCACTGGAAAAGGGAAAAGGG - Intergenic
912260417 1:108106756-108106778 CTGTACTAGACAATGGAAAACGG - Intergenic
912523803 1:110265990-110266012 CTCTATGTGAAAAGGGAACAAGG - Intronic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
914224237 1:145707222-145707244 CTGGCTTGGAAAAAGAAAAAGGG + Intronic
914839681 1:151238164-151238186 CCATACTGGAAAAGGCAAAAAGG - Exonic
914995622 1:152541104-152541126 TTGTATTGGGAGATGGAAAAGGG - Intronic
915002912 1:152609777-152609799 TTGTATTGGGAGATGGAAAAGGG + Intergenic
915852732 1:159343549-159343571 CTGAATTCCAAAAAGGAAAAAGG - Intergenic
917384957 1:174462471-174462493 CTGTATTAGAAATGGAACAAAGG - Intronic
917662430 1:177190486-177190508 CTGTTTTGGAGAAGGGAAGAAGG - Intronic
918029106 1:180786332-180786354 CTGTCTAGGAATAAGGAAAATGG - Intronic
918345165 1:183601323-183601345 CTGTATTGGAATTGGAAAATGGG - Intergenic
918882947 1:190150127-190150149 CTGTTTTCTAAAAGTGAAAATGG - Intronic
919074274 1:192795053-192795075 CAGAATTAGAAAAGTGAAAATGG + Intergenic
920063783 1:203249646-203249668 AAGTATTGGAAAAGGTAAAAAGG - Intronic
920524882 1:206659222-206659244 CTGGGTTGGAAAAGGGGCAAAGG + Intronic
921464398 1:215469224-215469246 CTGTAATGGAAACTGGGAAATGG - Intergenic
921472551 1:215567135-215567157 CTGAAATGTAAAAGGGAAAGGGG + Intergenic
923702228 1:236310882-236310904 CTGGGTTGGCAAAGGGAAAAAGG + Intergenic
923711742 1:236393247-236393269 ATTTATTGGAAAAGGAAAATTGG + Intronic
924804083 1:247348644-247348666 CTTTTCTGGAAAAGAGAAAAAGG - Intergenic
1063718484 10:8554276-8554298 CTGTATGGTCAAAGTGAAAAGGG - Intergenic
1064085539 10:12343635-12343657 CTACATTGGAAATGGCAAAAGGG - Intergenic
1064295890 10:14078931-14078953 CTCCACTGGAAAAGGGAAACAGG + Intronic
1064369154 10:14736025-14736047 GTGCCTGGGAAAAGGGAAAAGGG + Intronic
1065131763 10:22628892-22628914 CTGAATTCCAAAAGGGAAAATGG + Intronic
1065330313 10:24589969-24589991 CTGTTATGGAAATGGAAAAATGG + Intronic
1065638422 10:27754311-27754333 CTGTTTTGGAAAAGTGCTAAAGG + Intergenic
1066029477 10:31405249-31405271 AAGTATTGGAGAGGGGAAAAAGG + Intronic
1066408689 10:35144543-35144565 TAGTATTGACAAAGGGAAAAGGG + Intronic
1066410678 10:35166033-35166055 CTGAATTGAAAAGGGGGAAAAGG - Intronic
1068739078 10:60448498-60448520 CTGTCTTAGAAAACAGAAAATGG - Intronic
1069998471 10:72358048-72358070 TTGCATTGGAAAGGGAAAAATGG - Intergenic
1070409520 10:76126637-76126659 ATGTATTGCAAGATGGAAAAAGG - Intronic
1070733230 10:78846053-78846075 CTGTCCTGGAAACTGGAAAAAGG - Intergenic
1071141263 10:82511754-82511776 CTGTAGTGAACAAGGGAAAGGGG + Intronic
1071868354 10:89763448-89763470 CTGTATTGGAAGAGAAAAGAGGG + Intronic
1071900001 10:90109987-90110009 ATATAATAGAAAAGGGAAAAAGG + Intergenic
1072172575 10:92880280-92880302 CTGTATTGGATAGGGAATAATGG + Intronic
1072857571 10:98965573-98965595 CTGTTTGGGAAAAGTGAATACGG - Intronic
1072959733 10:99918484-99918506 CTGGATATGAAAAGGGGAAAGGG - Intronic
1073203988 10:101758900-101758922 CTGCCTAGGAAAAGGGGAAAAGG + Intergenic
1073479584 10:103778026-103778048 CTGAAGTTAAAAAGGGAAAATGG + Intronic
1074112457 10:110432168-110432190 ATGGATTGGAGAAGGGAAAGTGG + Intergenic
1075273549 10:121074157-121074179 CTGTTTTGGAAAAGGCAAGAAGG - Intergenic
1075327269 10:121543971-121543993 CTGTTTTGCAAAAGCAAAAATGG - Intronic
1076094672 10:127721257-127721279 CTGCTTTGGAAAAGGGAGGAAGG + Intergenic
1077346955 11:2064744-2064766 CGGAATTGGAAAAGGGGGAAGGG - Intergenic
1078106352 11:8360426-8360448 TTGTATTGGACAATGGACAATGG - Intergenic
1078727275 11:13942932-13942954 ATGTATTGGAATTGGGAGAATGG - Intergenic
1080501296 11:32873906-32873928 AGGTATTGGAAACTGGAAAATGG + Intergenic
1080595347 11:33768810-33768832 CAGTAATGGAAACGGGGAAAGGG + Intronic
1080995570 11:37596251-37596273 CTGTATTGAAATAGAGAAAATGG - Intergenic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1083676964 11:64331598-64331620 CAGTATGGGATAAGGGGAAAGGG + Intergenic
1084025450 11:66445629-66445651 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1084025850 11:66448879-66448901 CTGAATTCCAAAAGGGAGAAGGG - Intronic
1087778550 11:102278945-102278967 CTGTATTTGCAAAGGCATAAAGG + Intergenic
1088468971 11:110174198-110174220 CTGCATTGTAATAGGGAAAGTGG + Intergenic
1088657500 11:112014574-112014596 CTGTATTGGAAGACTGAAGATGG - Intronic
1088720923 11:112591026-112591048 CTTTATTGGGAAAGGGAGGAGGG - Intergenic
1089643824 11:119864992-119865014 ATGCGTTGGAAAAGGGACAAGGG + Intergenic
1089866462 11:121637288-121637310 CTGTATTGAAAAAGGTAAACTGG - Intergenic
1089925241 11:122250176-122250198 CTGTATTGTAAAAGGTGAGAAGG + Intergenic
1090921174 11:131207129-131207151 ATGGAGTGGACAAGGGAAAAGGG - Intergenic
1090924497 11:131237480-131237502 GTGTATAGGAAAAGGGAAAGAGG + Intergenic
1090952293 11:131484391-131484413 AAGTATTGGAGAAGGCAAAATGG + Intronic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1092087287 12:5773599-5773621 ATGGATTAGAAAAGGGGAAATGG + Intronic
1092393586 12:8104305-8104327 CTGGAATGAAAAAAGGAAAATGG - Intergenic
1093273103 12:17090557-17090579 ATGTTTTGGAAAAGGAAACATGG - Intergenic
1093281294 12:17199392-17199414 CTTTAATGGAAATGGGATAAGGG + Intergenic
1093427045 12:19039432-19039454 CTGAACTGGAAAAGCAAAAAGGG - Intergenic
1093623747 12:21322710-21322732 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1093983067 12:25496867-25496889 CTGTGCTGGAAAGGGGAGAATGG - Intronic
1094789698 12:33897859-33897881 CTGCAGTGGATATGGGAAAAAGG + Intergenic
1095834721 12:46625175-46625197 CTCTATTGGAAAAGCTATAAAGG - Intergenic
1096814396 12:54192640-54192662 CTGATTTGGGGAAGGGAAAAGGG + Intergenic
1097395436 12:59067566-59067588 CTGATTTGGAAAATGGGAAAAGG + Intergenic
1097401379 12:59132282-59132304 CTGCATTTGTCAAGGGAAAAGGG + Intergenic
1097406495 12:59196454-59196476 CTGTATTAAAAAAAGAAAAAAGG - Intergenic
1098132372 12:67363971-67363993 AGGCATTGGAAAAGTGAAAAGGG + Intergenic
1098470319 12:70835989-70836011 CAGTAGTGGAAAGGGGAAAAAGG - Intronic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1099862282 12:88235179-88235201 CGGTTATAGAAAAGGGAAAAGGG - Intergenic
1099896000 12:88647679-88647701 CTGTATAGAAAAAAAGAAAACGG - Intergenic
1100176146 12:92033144-92033166 CAGAATTGAAAAAGGGAGAAGGG + Intronic
1100738273 12:97562381-97562403 GTGTATTTTCAAAGGGAAAATGG + Intergenic
1100790245 12:98122299-98122321 CTGTATAGGCAAAGGAATAAGGG + Intergenic
1100928901 12:99584029-99584051 CTGTTGTGAAAAAGGAAAAAGGG - Intronic
1101483479 12:105127106-105127128 CTGAAACAGAAAAGGGAAAAGGG - Intronic
1101698626 12:107150911-107150933 CTTTATTCCAAAAGGGGAAAAGG + Intergenic
1101713042 12:107286504-107286526 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
1101963501 12:109266646-109266668 CTGTTTTGCAAAAGGAAACAGGG - Exonic
1103962307 12:124616848-124616870 CTGCATTTCAAAAGGGGAAACGG - Intergenic
1104112089 12:125713861-125713883 CTTTATTGGAAACGGGGAAAGGG - Intergenic
1104628404 12:130378568-130378590 TTGTAAAGAAAAAGGGAAAAGGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106789342 13:33138852-33138874 CTGTTTTGCAGAAGAGAAAAGGG - Intronic
1107386717 13:39918283-39918305 GTGTATTTTAAAAGGCAAAAAGG - Intergenic
1107418234 13:40221169-40221191 CTGTATTTGAAAAGGGACAGTGG - Intergenic
1108300176 13:49065719-49065741 CTGGATTTGAAAAGGAATAAGGG + Intronic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109353342 13:61210170-61210192 CTGAATTTGAGAAGGGAAAGTGG - Intergenic
1109674609 13:65658673-65658695 GTGTCTGGGAAAAGGGAATATGG - Intergenic
1110780373 13:79458832-79458854 CTTTCTCAGAAAAGGGAAAAGGG + Intergenic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111926338 13:94467324-94467346 CTGTTATGAAAAAGGGAAGAAGG - Intronic
1113228266 13:108182254-108182276 CTGTATTGAAAGTGGGAAACAGG - Intergenic
1113294595 13:108944349-108944371 TTGAAGAGGAAAAGGGAAAAAGG + Intronic
1113980172 13:114268116-114268138 CCGAGTTGGAAAAGGGAAAGGGG + Intronic
1114441617 14:22752795-22752817 CTGAATTCCAAAAGGGAAGAGGG + Intergenic
1114742535 14:25112781-25112803 GCCTATGGGAAAAGGGAAAAAGG - Intergenic
1115043742 14:28963297-28963319 CTTTATTGGAAATGAGGAAAAGG + Intergenic
1115303461 14:31910896-31910918 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1117629948 14:57680548-57680570 GGGTATTCGAAAAGGGAAAGAGG + Intronic
1117728542 14:58697518-58697540 CGGTATTTGAACAGGGAAAATGG + Intergenic
1119597808 14:75952369-75952391 CTGTAATGGAAAAGAGACATTGG + Intronic
1119987383 14:79153303-79153325 CTTTATTTGAAAAGGGAATATGG + Intronic
1120090772 14:80331046-80331068 ATGCATTGGAAATGGGAAGACGG - Intronic
1120622988 14:86789047-86789069 CTGTATTCCAAAAGGGAGGAGGG - Intergenic
1121250306 14:92494449-92494471 TTGGTTTGGAATAGGGAAAAAGG + Exonic
1121270780 14:92636739-92636761 ATGTATTTTAAAAGTGAAAATGG - Intronic
1121814381 14:96917817-96917839 CTGTTTTCGAAAAGGAAAAGAGG - Intronic
1121837405 14:97104402-97104424 CTGTAATGGGAATGGGACAAAGG - Intergenic
1122646207 14:103196109-103196131 CTGTAAAGGAAAAAGGAACAAGG + Intergenic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124685781 15:31780718-31780740 CTGTATTGGAGAAAGGGCAAAGG + Intronic
1126200715 15:45982741-45982763 CTGGATGGGAAAAGGAAAAATGG - Intergenic
1126282277 15:46967737-46967759 CTATATAGGTAAACGGAAAAGGG + Intergenic
1126310444 15:47310010-47310032 CTGTACAAGAAAAGGGAACATGG + Intronic
1126989387 15:54355002-54355024 CTTTATTGGAACAGGAAGAAAGG + Intronic
1127192592 15:56547170-56547192 CTGCATTTGAAAAGGTTAAAAGG + Intergenic
1128185980 15:65643835-65643857 CTCCAGTGGAAAAGGGGAAATGG - Intronic
1128422382 15:67506007-67506029 CACTATTGCAATAGGGAAAAGGG + Intergenic
1129615640 15:77097198-77097220 CAGTGTTGGAAAACAGAAAAGGG - Intergenic
1129929714 15:79400254-79400276 CTGATTTGGATAAGGGATAAGGG - Intronic
1130369117 15:83268605-83268627 CTGTCTTGGAACAAGTAAAAGGG + Intronic
1130597454 15:85257434-85257456 CTGCATTGGACAAGGGGAGAAGG + Intergenic
1130727206 15:86451676-86451698 AGGTAATGGAAAATGGAAAAGGG - Intronic
1131989613 15:98080528-98080550 CTGCCTAGGAAAAGGGAAAGGGG - Intergenic
1133668851 16:7997981-7998003 CTGTAGTGGAAAATGGAAGAGGG - Intergenic
1133753800 16:8746123-8746145 GTATTTTGGAAAAGGGAAAAAGG + Intronic
1134465952 16:14477775-14477797 CGGAAAGGGAAAAGGGAAAAGGG + Intronic
1134694124 16:16210438-16210460 CTGCATTAGAAAAGGGAACTTGG - Intronic
1134977714 16:18584204-18584226 CTGCATTAGAAAAGGGAACTTGG + Intergenic
1135418598 16:22288698-22288720 CTTTATTTGTAAAGAGAAAATGG - Exonic
1135873658 16:26176757-26176779 CTATATTAGAAAATGGGAAAGGG - Intergenic
1137031357 16:35527097-35527119 CTGTTCTGGGAAAGGGAGAAAGG - Intergenic
1137038280 16:35586277-35586299 ATGTATAGGACAAAGGAAAAAGG + Intergenic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1138010868 16:53378666-53378688 CCTTTTTAGAAAAGGGAAAATGG + Intergenic
1138440692 16:57033316-57033338 CCGTTTTAGAAAAGAGAAAAGGG + Intronic
1138600472 16:58051246-58051268 CTGAATTCCAAAAGGGAAAAGGG + Intergenic
1138988562 16:62362140-62362162 CTATATTGGACCAGGGAAAAGGG - Intergenic
1139341600 16:66271183-66271205 CTTGATTGCAAAAGAGAAAAGGG + Intergenic
1139361213 16:66401382-66401404 CTATTTTTGAAAAAGGAAAAAGG + Intronic
1139428917 16:66900703-66900725 CTGTGTTGGGAAAGGGACTAGGG + Intergenic
1139656963 16:68394240-68394262 CTGATTTGGAAAATGGAAAATGG - Intronic
1140240454 16:73195220-73195242 ATGGTTTGGAAAAGGGAGAAGGG + Intergenic
1140788897 16:78370431-78370453 TTACATTGGGAAAGGGAAAAAGG + Intronic
1141061195 16:80872707-80872729 CTGTATTTTAAAAAGGAAAAGGG + Intergenic
1141118027 16:81327636-81327658 CTACATTGGGAAAGAGAAAATGG + Intronic
1141466464 16:84208992-84209014 CTTTATTGGCAATGTGAAAACGG + Intergenic
1141607653 16:85163976-85163998 CTGTATTTAAAAAGGCAACAAGG + Intergenic
1142819185 17:2451189-2451211 CTTTATTTTCAAAGGGAAAAAGG - Intronic
1143149155 17:4796709-4796731 TGGTCTGGGAAAAGGGAAAAAGG - Exonic
1144043055 17:11429966-11429988 TTGAATTGGAAAAGGAAGAAAGG + Intronic
1144609614 17:16698507-16698529 CTGTACAGGATCAGGGAAAATGG + Intronic
1144903155 17:18617044-18617066 CTGTACAGGATCAGGGAAAATGG - Intergenic
1144927911 17:18828940-18828962 CTGTACAGGATCAGGGAAAATGG + Intergenic
1145129413 17:20329706-20329728 CTGTACAGGATCAGGGAAAATGG + Intergenic
1145289339 17:21530852-21530874 ATGTATTGGACATGAGAAAATGG + Exonic
1145317931 17:21745887-21745909 CTGTCTTGGAGATGGGGAAACGG - Intergenic
1147272514 17:39285569-39285591 ATGTACTGAAAAATGGAAAAAGG + Exonic
1149349295 17:55771161-55771183 CTCTGTTGGACATGGGAAAAGGG - Exonic
1149588528 17:57810395-57810417 CTGTATTGCAAAGGGGATAAAGG - Intergenic
1149966895 17:61173553-61173575 CTATATTAGAAAAGAAAAAAAGG + Intronic
1150543595 17:66129824-66129846 CTGAAATACAAAAGGGAAAAAGG + Intronic
1155283687 18:24267087-24267109 CAGTATTAGAAAAAAGAAAATGG + Intronic
1155687034 18:28566145-28566167 GAGTAGTGGAAAAGGGCAAAGGG + Intergenic
1158234490 18:55298319-55298341 CTGGTTTTGAAATGGGAAAATGG - Intronic
1158857257 18:61555011-61555033 CTGTGGTGGAAAAGTGACAAAGG - Exonic
1159953869 18:74506077-74506099 CTGTACTGGAAACAGAAAAACGG - Intronic
1160262609 18:77308885-77308907 AAGTATTGGAAAAGGCAATACGG - Intergenic
1162078835 19:8206875-8206897 ATGCATTTGAAAAGGGAAAGAGG + Intronic
1162090405 19:8276058-8276080 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162092638 19:8290891-8290913 CTGTATCTTAAAAAGGAAAAAGG - Intronic
1162215126 19:9127716-9127738 CTGTAATGAGAAAGGGAAATTGG - Intergenic
1164639652 19:29814650-29814672 CTGTATGTGAGCAGGGAAAAAGG - Intronic
1165190622 19:34059945-34059967 CAGTTTTGGCAAAGGGATAATGG + Intergenic
1166972737 19:46580771-46580793 CTGTAATGAACAAGGGAATACGG - Intronic
1168356909 19:55706348-55706370 CTGTTTTAGAAAAGTGAAAGAGG + Intronic
924975488 2:170836-170858 ATAGATGGGAAAAGGGAAAAGGG - Intergenic
926024231 2:9526463-9526485 CTGTATTGGAAAAATTAAAGAGG - Intronic
926967585 2:18432108-18432130 CTGTTTTGGAAAGGAGAATAAGG + Intergenic
927403264 2:22738628-22738650 GTATATAGTAAAAGGGAAAAAGG + Intergenic
927665986 2:25033235-25033257 CTGCATTGGCAAGGGGGAAATGG - Intergenic
928879106 2:36076994-36077016 CAGGATTTGAGAAGGGAAAATGG + Intergenic
930345823 2:50179867-50179889 CAGTATAGGAAAAGGGAAGGAGG - Intronic
930874608 2:56200646-56200668 GTGTTTTTGAAAAGGGAAAATGG + Intronic
931123630 2:59249319-59249341 CTATCTTGAAAAAGGGGAAAGGG + Intergenic
931901252 2:66790950-66790972 CTCAATTGGAATAGGGTAAAGGG + Intergenic
932092333 2:68817568-68817590 CTGGACTAGAAAAGGTAAAATGG - Intronic
935720928 2:105978568-105978590 TTGTTTTGAAAGAGGGAAAATGG - Intergenic
936481198 2:112886375-112886397 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
936616951 2:114057536-114057558 TTGATTTGGAAAAGTGAAAAGGG + Intergenic
937287901 2:120764585-120764607 CTGTGTTGTAGAAGGGAACAGGG + Intronic
939103595 2:137924430-137924452 CTATATTGGAAGAGTCAAAAAGG - Intergenic
939668778 2:144983182-144983204 ATGTATTGAAACAGGAAAAATGG - Intergenic
939836520 2:147136030-147136052 ATATATTAGAGAAGGGAAAACGG - Intergenic
941469503 2:165866945-165866967 CTATATTGTAAAAGAGAGAAAGG + Intronic
942493008 2:176508785-176508807 CTGTCTTTGAAAACGGAGAAAGG - Intergenic
942569176 2:177295931-177295953 TCTTATTGTAAAAGGGAAAAAGG - Intronic
942902173 2:181134258-181134280 CTGTTTTGGCAAAGGTCAAAAGG - Intergenic
942920289 2:181364979-181365001 CCGGATTGCAAAAGGGAGAAGGG - Intergenic
943094739 2:183415821-183415843 CTAAATTAGGAAAGGGAAAATGG + Intergenic
943415683 2:187600242-187600264 TTTTATTACAAAAGGGAAAAGGG - Intergenic
943543404 2:189244812-189244834 CTTTATTGGCAGAGTGAAAATGG - Intergenic
943729828 2:191290712-191290734 GTATATTGGAAGAGGCAAAAAGG - Intronic
944036201 2:195297397-195297419 CTCTATTGGTAAATGGAATAGGG + Intergenic
944565732 2:200989155-200989177 CTAGATTTGAATAGGGAAAAAGG + Intronic
944962810 2:204894936-204894958 ATTTATTTTAAAAGGGAAAATGG + Intronic
944989846 2:205223206-205223228 ATATAATGGAAAAGGTAAAAAGG + Intronic
945209064 2:207363778-207363800 CTGCTCTGAAAAAGGGAAAAGGG + Intergenic
945577359 2:211548701-211548723 CTGTGTTGGAGATGGGGAAACGG - Intronic
946029537 2:216693597-216693619 CTGAATTGGAGAGGGGGAAAAGG + Intronic
946488053 2:220119943-220119965 ATTAATTGGCAAAGGGAAAAAGG + Intergenic
947159469 2:227197708-227197730 CTATCTTGGAAAAGTGGAAATGG + Intronic
947392337 2:229651979-229652001 CTCAATTAGAAAAGGAAAAATGG + Intronic
947454689 2:230243229-230243251 CTGGATTGGAGAAGGGTAAATGG - Intronic
947756743 2:232571542-232571564 CTGGAATGGAAAAGGAAAACAGG + Intronic
948094316 2:235321427-235321449 CTGAAATGGCAAGGGGAAAAGGG - Intergenic
948246599 2:236491569-236491591 TTGTGTTGGAAAATGGAGAAGGG - Intronic
948269616 2:236664298-236664320 CTGAATTGGAAAAGGCACTAAGG + Intergenic
948489873 2:238305675-238305697 CTGTTTTGGTACAGGGTAAAAGG + Intergenic
948612319 2:239177870-239177892 CGGTATCGGAAAAGGTGAAAAGG + Intronic
948766283 2:240222712-240222734 CTGTATTAGAAAAGAAAAAAAGG - Intergenic
1169979848 20:11372118-11372140 CTTTATTAGAAAAGTGAATATGG + Intergenic
1170056467 20:12210417-12210439 TTGCCATGGAAAAGGGAAAAAGG + Intergenic
1170104070 20:12734833-12734855 CTGTCTTGCTACAGGGAAAAAGG - Intergenic
1173430281 20:42981836-42981858 ATCCATTAGAAAAGGGAAAAAGG - Intronic
1175070006 20:56325218-56325240 CTCTAGTGGAAAGGGGAATATGG - Intergenic
1175712026 20:61228953-61228975 CTATAATGCAAAAGGGAAAGAGG + Intergenic
1178306406 21:31494365-31494387 CTTCATTGGAAATAGGAAAAGGG - Intronic
1178996692 21:37408107-37408129 CTCTTCTGGGAAAGGGAAAAGGG - Intronic
1179146854 21:38775520-38775542 CTGTATTGGAATGGGGATGAGGG + Intergenic
1180015094 21:45076492-45076514 CTGTAGTTGGAAAGGAAAAAAGG + Intronic
1180124314 21:45778730-45778752 CTGTCTTGGAATAGGGTAAGAGG + Intronic
1180319291 22:11305970-11305992 CTTTATTGGCAATGTGAAAATGG - Intergenic
1181418911 22:22783628-22783650 CTGCATTGGAGGAGGGACAAGGG - Intronic
1181424672 22:22826486-22826508 CTGAATTCCAAAAAGGAAAAGGG - Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1182598960 22:31444787-31444809 TTGAATTGGATAAGGGAAAGGGG - Intronic
1183016002 22:34987638-34987660 ATGTAATTGAAAAGGTAAAATGG + Intergenic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
949403329 3:3688436-3688458 CTGTATTCCAAAAGGGAGGAGGG + Intergenic
949712073 3:6882583-6882605 ATTTATTGGAAATGGGATAATGG - Intronic
949815208 3:8050957-8050979 CTGTATTTGAAAAAGACAAATGG - Intergenic
950091339 3:10297284-10297306 GTGTTTGGGAAAAGGGAAACAGG - Intronic
950352441 3:12369594-12369616 GTGTTTTGGAAAAGGGAATATGG - Intronic
950938153 3:16864355-16864377 CTGGAAACGAAAAGGGAAAATGG - Intronic
950984100 3:17341909-17341931 CTGTATTGGGGATGGGAAGAGGG - Intronic
952814230 3:37432941-37432963 CTGTAATGGAATAGGGCAAAAGG + Intronic
953115250 3:39986606-39986628 CTGGACTGGCAAAGGGAAATGGG - Intronic
953716376 3:45319859-45319881 CTGCTCTGGAAAAGGGAAAGAGG + Intergenic
954924744 3:54223429-54223451 CTGTATAGGAAAATGATAAATGG + Intronic
955402182 3:58600170-58600192 CTTTTTTGGAAAGGGGAAAAGGG + Intronic
955476530 3:59341779-59341801 CTCTCATGGAAAAGGGGAAATGG - Intergenic
956262259 3:67356947-67356969 CTGTAGTTGAAAAAGGAAAATGG - Intergenic
956425420 3:69129478-69129500 CTGTTTTAGAAAAAGTAAAATGG - Intergenic
956501343 3:69888853-69888875 CTGTCTTGGTGAAGAGAAAAGGG + Intronic
956594583 3:70951859-70951881 CTATATTGAAAAGGGGAAAAAGG + Intergenic
956916495 3:73877324-73877346 CTGAATTGGAAAAGGTAATTTGG - Intergenic
957791315 3:84944599-84944621 TTGTAATGGAAAATGGAATAGGG + Intergenic
958872276 3:99574621-99574643 CTGTAGTAGAAAATGGACAAAGG + Intergenic
959266572 3:104147718-104147740 TTGTCTTGCAAAAGGGAAATTGG + Intergenic
961957441 3:130818564-130818586 CTGAATTCCAAAAGGGAGAAGGG - Intergenic
962028117 3:131570469-131570491 CAGTATTTGAAAAGAAAAAATGG - Intronic
962159300 3:132981956-132981978 CAAGATTGGAAAAGGAAAAAGGG + Intergenic
963024854 3:140909601-140909623 CTGTATTGGAAAATAAAAAAAGG - Intergenic
963807101 3:149734108-149734130 CTATAGTGGAATAGAGAAAAGGG - Intronic
966931256 3:184677305-184677327 CTGTAGTGAAGAAGGAAAAATGG + Intronic
967301380 3:188017589-188017611 CAGTTTTGCAAAAAGGAAAATGG - Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
970240136 4:14000803-14000825 CTGTCCTGGAAAAGACAAAAGGG - Intergenic
971037869 4:22714782-22714804 CTCTATTGGAAGAGGGAGCAAGG + Intergenic
971817620 4:31509099-31509121 ATGTATTCCAAAAAGGAAAAGGG - Intergenic
971884749 4:32429430-32429452 CTGTCTTTGAAAATGGATAATGG + Intergenic
971909679 4:32779355-32779377 CAGTACTGGAAAAAGGGAAAAGG - Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
972189713 4:36575176-36575198 CTGTCTTGGAAAAAAAAAAAGGG - Intergenic
972335730 4:38106062-38106084 CTGTATCCTATAAGGGAAAAAGG - Intronic
972932190 4:44085792-44085814 CTATATTGGAAAAGAAAAAAAGG - Intergenic
972968287 4:44539884-44539906 ATGCATTGGAAAAGCGAAATAGG - Intergenic
973208855 4:47592033-47592055 CTTCATTGGAAAGGGGAAAGAGG + Exonic
973842030 4:54872222-54872244 ATATATTGGGAAAGGGAAACAGG - Intergenic
974035690 4:56816096-56816118 CAGTCTTGGAAAAAAGAAAAAGG + Intronic
974062980 4:57052341-57052363 CTGGATTGAAGAAGGGGAAAGGG + Intronic
974267850 4:59608527-59608549 TTATATTGGAAAAGTGAAGATGG + Intergenic
974434779 4:61842884-61842906 CTATATTGGAAATTGGAAACAGG + Intronic
974728116 4:65823156-65823178 CTGGCTTTGAAAATGGAAAAAGG + Intergenic
975610072 4:76194767-76194789 AGGTATTGTAATAGGGAAAAGGG + Intronic
976239461 4:82939494-82939516 TTGTATTGCAAAAGTGATAATGG - Intronic
976340154 4:83938148-83938170 CTGTAATGGAAGAGGGATAGAGG - Intergenic
976622558 4:87143675-87143697 TTATGTTGGAAAAGGGGAAAGGG + Intergenic
978218985 4:106246004-106246026 CTATATTGGAAAAGGAATAAGGG + Intronic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
978584246 4:110260686-110260708 ATGAATTGGAAATGAGAAAAGGG + Intergenic
979608087 4:122660333-122660355 CTGAATTGGAATAAGGAATAAGG - Intergenic
980299041 4:130964439-130964461 CTTTATTGGCAATGTGAAAATGG + Intergenic
980492023 4:133540737-133540759 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
980760303 4:137223973-137223995 CTTTTTTGGAAAGGGGAAACAGG + Intergenic
981030772 4:140123296-140123318 CAATTTTGGAAAAAGGAAAAAGG + Intronic
981979646 4:150775602-150775624 CTAGATTGGAATAGGAAAAAGGG + Intronic
982214742 4:153071320-153071342 CTTTATTGGCAATGTGAAAACGG - Intergenic
982547545 4:156753890-156753912 CCGTTTTAGAAAAGTGAAAATGG + Intergenic
982623441 4:157733681-157733703 ATGTATGGGAAACGAGAAAAAGG + Intergenic
982780473 4:159485517-159485539 AAGTATTGGAAAATGGGAAAAGG + Intergenic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985470544 5:41296-41318 ATAGATGGGAAAAGGGAAAAGGG - Intergenic
987608594 5:20172341-20172363 TTATAGTGGAACAGGGAAAAAGG - Intronic
988734363 5:34006190-34006212 CGGTATAGAAAAAGAGAAAAGGG - Intronic
988922202 5:35953935-35953957 GTGTCTAGGAAAAGGGAGAAAGG + Exonic
989564045 5:42883802-42883824 CTGAATTCTAAAAGGGAAGAGGG - Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991603446 5:68376585-68376607 TTGTCTTGGAAAAGAGGAAATGG - Intergenic
992129587 5:73678364-73678386 CTGTACTGAAAAATGGCAAATGG + Intronic
992769973 5:80037860-80037882 CTGCATTTCAAAAGGGAAATTGG - Intronic
992875251 5:81047757-81047779 CTTTACTGGAAAAGAGAATAAGG - Intronic
993531721 5:89033541-89033563 TTGTATTGGAAAAAGAACAAGGG + Intergenic
993536339 5:89091534-89091556 CTCTAATGGAAAAGAGGAAAAGG - Intergenic
994101229 5:95894869-95894891 CTAGAATGTAAAAGGGAAAATGG - Intronic
994390800 5:99191092-99191114 CTGTAATGGAATAAGCAAAAGGG - Intergenic
994946516 5:106400311-106400333 CTGTATTCCAAAATGGTAAAAGG + Intergenic
995546228 5:113234610-113234632 CTGTATTTTTAAAGGGAAATTGG - Intronic
995594347 5:113731725-113731747 CTGAATTCTAAAAGGGAGAAGGG + Intergenic
995743512 5:115379153-115379175 CTGCCTTGGAAATTGGAAAATGG - Intergenic
995788037 5:115852232-115852254 CTGTTTTGGTAAAAGGCAAAAGG + Intronic
996478043 5:123943057-123943079 CTGTTATGGTACAGGGAAAAGGG - Intergenic
998358697 5:141565289-141565311 CTTTACTGGAAAAGGGGCAAGGG - Intronic
1000657121 5:163892987-163893009 ATGAATTTCAAAAGGGAAAAGGG - Intergenic
1001182284 5:169531582-169531604 CTGTATTGGCAAAGAGCAAAGGG + Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001271537 5:170315984-170316006 CAGTCTTGGAAAGTGGAAAATGG - Intergenic
1001727668 5:173920278-173920300 GTGTATTGGAAAAGAGAAGGAGG + Intronic
1001781890 5:174375894-174375916 CTGTATTGAAATTGAGAAAACGG + Intergenic
1001949327 5:175805433-175805455 TTGTTTTGCAGAAGGGAAAACGG + Intronic
1002079668 5:176729854-176729876 CTGTTTAAGAAAAGGGCAAAAGG + Intergenic
1002128438 5:177064489-177064511 CTGTATTTGAGAAGGAACAAAGG - Intronic
1004215579 6:13701104-13701126 CTGTCCTGGAAGAGGAAAAAGGG - Intronic
1004227643 6:13801521-13801543 CTTTATTCCAAAAGGGGAAAAGG + Intronic
1004517481 6:16332644-16332666 TCCTATTGGAAAAGGGAAATTGG + Intronic
1004784639 6:18953294-18953316 ATATATTGCAAAAGGGAATAAGG + Intergenic
1005423969 6:25681928-25681950 CTGAAATGCAGAAGGGAAAATGG - Intronic
1005737489 6:28762145-28762167 TTGAAGTGAAAAAGGGAAAATGG + Intergenic
1006993786 6:38238893-38238915 CTGAATTCTAAAAGGGAAGAGGG + Intronic
1007617981 6:43193373-43193395 GTGTTTGGAAAAAGGGAAAAGGG + Intronic
1007850612 6:44799248-44799270 CTGAAATGGAGAAGGTAAAATGG - Intergenic
1008235210 6:49038265-49038287 CTATACTGGAAAAGGTAAAGTGG - Intergenic
1008316895 6:50054725-50054747 CCAAACTGGAAAAGGGAAAATGG + Intergenic
1008627683 6:53334198-53334220 TTGTGCTGGAAAAGGGGAAATGG - Intronic
1008730264 6:54473579-54473601 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1009807636 6:68622844-68622866 CTTTATTTTAAATGGGAAAAGGG + Intergenic
1011029544 6:82907057-82907079 CTGTATGGGTAAAAGAAAAATGG + Intronic
1011558979 6:88596225-88596247 CTGTCTTGGAAAGGAGAAGAAGG + Intergenic
1012447784 6:99324228-99324250 CTTTTTTTAAAAAGGGAAAAAGG - Intronic
1013675780 6:112460818-112460840 GTGTTTTGGAAAAGGGATAGAGG - Intergenic
1014592627 6:123292472-123292494 CTAAATTCCAAAAGGGAAAAGGG - Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015245675 6:131071905-131071927 CTGTTTTGGAAAAGGCTAACAGG + Intergenic
1015823818 6:137291202-137291224 CTGGTTTGGAAGAGGGGAAATGG + Intergenic
1015917937 6:138236998-138237020 CTGTATTTGAAAAAAAAAAAAGG - Intronic
1016635710 6:146287760-146287782 CTGGTTTTGAAAAGGGAAAAGGG + Intronic
1016972457 6:149776808-149776830 TTGTATTGGAAATGGAAAACTGG + Intronic
1017331230 6:153199908-153199930 AAGAATTTGAAAAGGGAAAATGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017662196 6:156685943-156685965 CTACAGTGGGAAAGGGAAAAAGG - Intergenic
1018138986 6:160807745-160807767 CTGAATTACAAAAGGGAAGATGG - Intergenic
1018203303 6:161414574-161414596 CTGTTTTGAAAAATAGAAAATGG + Intronic
1018948301 6:168362415-168362437 CTTGATTGGAAAAGAGAGAAGGG - Intergenic
1019573979 7:1727412-1727434 CTCTCATGGAAAAGAGAAAAGGG - Intronic
1019986003 7:4656421-4656443 CTGGATAGGAAAAGGGGGAAGGG - Intergenic
1020037934 7:4976358-4976380 CTGCATTTGAAAATGGAAGAGGG + Intergenic
1020159767 7:5761059-5761081 CTGCATTTGAAAATGGAAGAGGG - Exonic
1020191912 7:6006883-6006905 ATGTATTGGAGCAGGGAATAAGG - Intronic
1020786255 7:12576765-12576787 CTAGATTGGAACAGAGAAAATGG - Intronic
1020808436 7:12820908-12820930 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1020960084 7:14791454-14791476 TTGAATTGAAAAAGGGATAATGG + Intronic
1021228124 7:18052262-18052284 CTGTTTTGGGAAAGTTAAAATGG + Intergenic
1021972765 7:25981664-25981686 CTGTCTTAGCAAAGGGAAAGAGG - Intergenic
1022314962 7:29237175-29237197 TTATAATGGAAAATGGAAAAGGG - Intronic
1022755739 7:33286917-33286939 CTGTAATATAAAAGGGAAATGGG + Intronic
1022802049 7:33786126-33786148 CTGTATTGGAGAGGGGAAGGAGG + Intergenic
1022985448 7:35649861-35649883 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1023912959 7:44568377-44568399 GTGTCATGGAGAAGGGAAAATGG - Intronic
1024935469 7:54707644-54707666 CTTTACTGGAAAAGGGAAACTGG - Intergenic
1026165752 7:67907816-67907838 TTGTAATGGGAAAGGGAGAAGGG + Intergenic
1026219996 7:68387184-68387206 TTGTAATGGGAAAGGGAGAAGGG + Intergenic
1026276229 7:68879409-68879431 CTGTTTTGAAAAGGGAAAAAGGG - Intergenic
1027711509 7:81608216-81608238 CTGTAGTGGAAAACAGAAATAGG + Intergenic
1027889615 7:83954077-83954099 CTGTATGGAAATAGAGAAAAAGG - Intergenic
1027939643 7:84658782-84658804 GTGAATTGGAAAAGCTAAAAAGG - Intergenic
1028781506 7:94742744-94742766 TTCTATTGCAATAGGGAAAAGGG - Intergenic
1028898785 7:96072357-96072379 CTGTTAAAGAAAAGGGAAAAAGG - Intronic
1031202088 7:118701045-118701067 CTTTACTGGCAAAGGCAAAATGG + Intergenic
1031346807 7:120676834-120676856 CTGGATAGGAAAAAGAAAAAAGG + Intronic
1031756658 7:125652224-125652246 CCTTATTTGAATAGGGAAAAGGG + Intergenic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1033198900 7:139351535-139351557 CTGTGTTGCATAGGGGAAAATGG - Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1033571081 7:142629191-142629213 GTGTGTTGGTAAAGGGTAAAGGG - Intergenic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1034288724 7:149910046-149910068 CTGTTTTGCAAATGAGAAAAGGG + Intergenic
1034662353 7:152782821-152782843 CTGTTTTGCAAATGAGAAAAGGG - Intronic
1034882268 7:154771699-154771721 CAGAATTGGAAAAGGCAGAAAGG - Intronic
1035150752 7:156870440-156870462 CTGGATTGAAAAAGAAAAAAAGG + Intronic
1037044669 8:14283302-14283324 GAGTTTTGGAAAAGTGAAAAGGG - Intronic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1037474769 8:19246290-19246312 CTGTACTGGAAATGGAACAAAGG + Intergenic
1037556808 8:20033112-20033134 TTGAATGGGAAAAGGGAACACGG + Intergenic
1038155439 8:24985082-24985104 CAGTCTAGGAAAAGGGAACAGGG + Intergenic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038478433 8:27885155-27885177 CTGTCTTGGACAAGTGAACAAGG + Intronic
1038752729 8:30312241-30312263 TTAGAATGGAAAAGGGAAAAGGG + Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1040802307 8:51356755-51356777 CTTTTAAGGAAAAGGGAAAAGGG - Intronic
1040916315 8:52569212-52569234 GTGCATTGGGAAAGGGAAATAGG - Intergenic
1040932220 8:52747231-52747253 CTGTAAAGGAAAAGAGAACAAGG + Intergenic
1041187856 8:55320470-55320492 TTGTTTTGGAAAAGGGTAGAAGG + Intronic
1041933979 8:63316593-63316615 GTCTCTTGGAAAAGGGAAAGAGG - Intergenic
1041965306 8:63668801-63668823 TTGTATTAGAAAAGAAAAAAAGG - Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042933487 8:74035610-74035632 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1042948251 8:74176065-74176087 CTGTAGTGGCAAGAGGAAAAGGG + Intergenic
1043009213 8:74860756-74860778 CTGTATTTGAAAATGAAAATAGG + Intergenic
1043506745 8:80910114-80910136 GGTTATTGAAAAAGGGAAAAGGG + Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1044262594 8:90144757-90144779 CAGTAGGGGAAAAGTGAAAATGG - Intergenic
1044922784 8:97183386-97183408 AGGTATTGGTGAAGGGAAAATGG - Intergenic
1045129055 8:99127834-99127856 CTGTATTTTAAAAGGTAAGAAGG + Intronic
1045855913 8:106765378-106765400 CTGTATGGAGAAAGTGAAAATGG + Intronic
1045881059 8:107041386-107041408 CTGCAATGGAAAAAGGGAAAGGG + Intergenic
1045887678 8:107118937-107118959 CTGTATGGGAAAATGGAAATGGG - Intergenic
1046945900 8:119974059-119974081 CTGGAAAGGAAAGGGGAAAAAGG + Intronic
1048188526 8:132266428-132266450 CTGTTTTGCAGACGGGAAAATGG + Intronic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1048830974 8:138477225-138477247 TTCTATTGGAGAAGGGTAAAAGG - Intronic
1050124677 9:2344394-2344416 CAATATTGCAAAAGGGAGAATGG - Intergenic
1050162241 9:2730917-2730939 CTTTTGTGGAAAAGAGAAAAAGG - Intronic
1050288445 9:4129046-4129068 ATGTTCTGGAAAATGGAAAATGG + Intronic
1051250400 9:15153017-15153039 CTGAGTGGGGAAAGGGAAAAAGG - Intergenic
1051407695 9:16756478-16756500 ATGTATTGGAAGGGAGAAAAAGG - Intronic
1052196241 9:25718333-25718355 TTATCCTGGAAAAGGGAAAAGGG - Intergenic
1052340846 9:27362849-27362871 CTGTAAGGCAGAAGGGAAAAGGG - Intronic
1053464910 9:38298892-38298914 TTATATTTAAAAAGGGAAAAAGG + Intergenic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055603883 9:77948402-77948424 CTTTGCTGGAAAAGGGTAAAAGG - Intronic
1055686297 9:78778436-78778458 CTTTAGTGGAACAGGGAAGAAGG + Intergenic
1055810669 9:80144175-80144197 CTCTATTGGAACAGAGAGAAAGG + Intergenic
1056717513 9:89044593-89044615 ATGTTTTTGAGAAGGGAAAAAGG + Intronic
1058083478 9:100723568-100723590 CAGTATTAGAAAAGGCAAACAGG + Intergenic
1058355077 9:104074861-104074883 CTGGAATGGGAAAGGGAAAATGG + Intergenic
1059185792 9:112269398-112269420 CTGTTTTTAAAAAGGGTAAAAGG - Intronic
1185921725 X:4100511-4100533 CTGTATAGTAAAACAGAAAAGGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186270908 X:7887031-7887053 CCATTTTGTAAAAGGGAAAAAGG + Intergenic
1186328516 X:8507163-8507185 CTGAATTGTAGAAGGGAAGAGGG + Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186588090 X:10898115-10898137 CTATTTTCAAAAAGGGAAAAGGG + Intergenic
1186658438 X:11642049-11642071 GTGAATTGAAAAAGAGAAAATGG - Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1186714210 X:12232972-12232994 CTATATTTGAAAAGTAAAAATGG - Intronic
1186801248 X:13094230-13094252 TTGACTAGGAAAAGGGAAAAAGG - Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1187863699 X:23704876-23704898 CTGCATTAGGAAGGGGAAAAAGG + Intronic
1189029783 X:37438735-37438757 ATGTATTAAAAAAGAGAAAAGGG - Intronic
1189136280 X:38554010-38554032 CATTATTGGAATAGTGAAAATGG - Intronic
1189188081 X:39071140-39071162 CTGAATTCCAAAAGGGAGAAGGG + Intergenic
1189511074 X:41662042-41662064 CTGTCTTGTAAAAAGGACAAGGG - Intronic
1189677223 X:43473775-43473797 TTGACCTGGAAAAGGGAAAATGG - Intergenic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1193611827 X:83640917-83640939 GTGGATTGGAAAAGGGAAATTGG - Intergenic
1194156114 X:90391266-90391288 CAGTACTGGATATGGGAAAATGG - Intergenic
1194377916 X:93158761-93158783 CCTTATTGAAAAATGGAAAAAGG - Intergenic
1195251503 X:103052354-103052376 CTGGATTGGAGAAGGGTAAGAGG + Intergenic
1195801311 X:108714745-108714767 CTGTACAGCAAAGGGGAAAAGGG - Intergenic
1196096568 X:111807373-111807395 CTGTAGTGGAAAAGTGCAATTGG - Intronic
1196647353 X:118132200-118132222 AAGTATATGAAAAGGGAAAAAGG + Intergenic
1197045369 X:121990792-121990814 CTGTAATGGAAAAGGAAACAAGG + Intergenic
1197864847 X:131006911-131006933 CTGGATTTGGAAAGGGCAAAGGG + Intergenic
1197884784 X:131207164-131207186 GTGTATTGGATAGGAGAAAACGG - Intergenic
1198059004 X:133024935-133024957 CTGTATTAGAACATGGAAAGAGG + Intronic
1198408220 X:136338160-136338182 CTGTATTGAAAAAAAAAAAAAGG - Intronic
1198607465 X:138357205-138357227 CTATACTGAAAGAGGGAAAAGGG - Intergenic
1199361302 X:146922213-146922235 CGAAATTGGAAATGGGAAAAAGG + Intergenic
1199431405 X:147764491-147764513 CTGTAGCAGAAAAGGGAAAAAGG - Intergenic
1199857119 X:151768435-151768457 CTGTACTGGAAAAGGGACTGCGG + Intergenic
1199891182 X:152083840-152083862 CTGTTCAGGAAAAGGGAAAGTGG - Intergenic
1200502460 Y:3968239-3968261 CAGTACTGGATATGGGAAAATGG - Intergenic
1201433788 Y:13933766-13933788 CTGAATTGTAGAAGGGAAGAGGG - Intergenic
1202062230 Y:20899660-20899682 CAGTTTTTGAATAGGGAAAATGG - Intergenic