ID: 1033472383

View in Genome Browser
Species Human (GRCh38)
Location 7:141661709-141661731
Sequence TCTGGACACGAATTCTCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033472383_1033472386 -5 Left 1033472383 7:141661709-141661731 CCTCCAGAGAATTCGTGTCCAGA 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1033472386 7:141661727-141661749 CCAGATGAAGAGACTTAGAGTGG 0: 1
1: 0
2: 0
3: 28
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033472383 Original CRISPR TCTGGACACGAATTCTCTGG AGG (reversed) Exonic
900242302 1:1622966-1622988 TGTGGACACGAGTCCTCTGAGGG + Intronic
909592475 1:77366266-77366288 TCTGCAGAGAAATTCTCTGGGGG - Intronic
910408617 1:86915587-86915609 TCTGGATACGAATTCTTTTGGGG + Intronic
910762342 1:90746314-90746336 TCTGGTCTGGAAATCTCTGGGGG - Intergenic
911065354 1:93782913-93782935 TCTGGATACTAATTCTTTGTTGG - Intronic
916459850 1:165012166-165012188 TCTGGAAACAAATGCTCTGCTGG + Intergenic
920748578 1:208652344-208652366 TCTTGACAGAAAATCTCTGGAGG + Intergenic
923011387 1:230090587-230090609 CCTGGACTCGAATTTTCTGTTGG + Intronic
923356007 1:233156592-233156614 TCGGGGCAAGACTTCTCTGGAGG + Intronic
1065749428 10:28872136-28872158 TGTGGACATGAAGACTCTGGAGG + Intronic
1067163343 10:43845401-43845423 TCTGGACAGGAAGTACCTGGAGG - Intergenic
1071861394 10:89676780-89676802 TCTGGACCTGAATTCTTAGGTGG - Intergenic
1077327364 11:1969543-1969565 TCTTGACTCGATTTCTCTGTGGG - Intronic
1078609408 11:12807310-12807332 TCAGGAAACGAATTCTCTGTAGG + Intronic
1080708819 11:34725814-34725836 TCTGGATACTAATTCTTTGTAGG - Intergenic
1202810346 11_KI270721v1_random:24723-24745 TCTTGACTCGATTTCTCTGTGGG - Intergenic
1092291541 12:7162394-7162416 GCTGGACACAAATGCACTGGCGG + Intergenic
1092530482 12:9340244-9340266 CCTGGACAAGAATTGTATGGTGG + Intergenic
1096590899 12:52658642-52658664 TCTGGTCAGGAGTCCTCTGGAGG + Intergenic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1112376572 13:98847928-98847950 GCTGGACACGCCTTCTTTGGGGG - Intronic
1117144086 14:52819533-52819555 TCTTGACAAGTATTATCTGGTGG - Intergenic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1123201236 14:106666390-106666412 TCTGATCACGATGTCTCTGGAGG - Intergenic
1127158716 15:56157101-56157123 TCTGGATACTAATCCTCTAGTGG + Intronic
1130415007 15:83685229-83685251 TCTGGATACAAATTCTTTGTTGG + Intronic
1133929597 16:10221497-10221519 TCAGGACACGATGTCTCTGATGG - Intergenic
1135524054 16:23200118-23200140 TTTGGAAACCACTTCTCTGGAGG - Intronic
1141025921 16:80548066-80548088 TCTGGACCCACATTCTCTGAAGG + Intronic
1149686562 17:58538902-58538924 TCCTGGCAGGAATTCTCTGGTGG - Intronic
1150379576 17:64709919-64709941 TCTGGAAACGAGATCTCAGGAGG + Intergenic
1152041979 17:77909504-77909526 TCTGGACTCCAGTTCTCTGGTGG - Intergenic
1153546610 18:6213023-6213045 TCTGCACAATAATTTTCTGGGGG - Intronic
1154361135 18:13662057-13662079 TCTGGACTTGAATGGTCTGGGGG - Intergenic
1167438330 19:49493157-49493179 TCTGGAGTCGGCTTCTCTGGTGG - Intergenic
925285736 2:2714479-2714501 TCTGAAGACGTATTCTCTGCTGG - Intergenic
925745053 2:7036811-7036833 TTTGTACAAGAATTCTCTGGGGG + Intronic
928681350 2:33706224-33706246 TCTGAACACAAATTGTCAGGAGG + Intergenic
928919467 2:36511724-36511746 TCTGGCCAAGAATTCTCTTTTGG - Intronic
932664063 2:73682318-73682340 TCTGGATACAAATTCTTTGCTGG - Intergenic
937910494 2:127073347-127073369 TCTGAGAAAGAATTCTCTGGAGG + Intronic
940626766 2:156185315-156185337 TCCAGACAGGAATTCTCTGAAGG + Intergenic
945159428 2:206874066-206874088 TCTGCACACCATTTCTCTGTTGG + Intergenic
946017723 2:216617446-216617468 GCTGGAAACGACTTTTCTGGAGG - Intergenic
946903379 2:224393769-224393791 TCTGGCCTAGAATTCTTTGGGGG + Intronic
947396895 2:229695473-229695495 TCTGGGCATTAATGCTCTGGTGG + Intronic
947466823 2:230358331-230358353 TCTAGACACCAATTCCCTGTGGG - Intronic
1169551416 20:6705355-6705377 GCTGTACATGAATCCTCTGGAGG + Intergenic
1170873963 20:20233645-20233667 TCTGGATCCTTATTCTCTGGTGG - Intronic
1174572257 20:51510225-51510247 TCTGCACAGAAATTCCCTGGAGG - Intronic
1175980723 20:62737378-62737400 TCTGGACACGCATCCTAGGGTGG - Intronic
1178423898 21:32463583-32463605 TCTGGGGACGAAATCGCTGGAGG + Intronic
1180142303 21:45899994-45900016 TTTGGAAAGGAATTGTCTGGGGG - Intronic
1182466666 22:30521131-30521153 TCTGGACAAGAGGTCTCTGCAGG + Intergenic
1183339240 22:37269896-37269918 TCTGGACATTAATTCTTTGTTGG - Intergenic
954851833 3:53607636-53607658 TCTGGACTCTTATTCTCTGGGGG - Intronic
955257008 3:57342706-57342728 TCTGGATATTAATTCTTTGGTGG - Intronic
959921251 3:111870704-111870726 TCTTTACAGGAATTCTGTGGGGG - Intronic
959946478 3:112130802-112130824 TCTGGACACGGATACTCTCAAGG - Intronic
961444084 3:126970640-126970662 TCTGGATAGGGGTTCTCTGGGGG + Intergenic
965918674 3:173884192-173884214 AATTGACAAGAATTCTCTGGGGG + Intronic
970418767 4:15884830-15884852 GCTGGACTTGAATTCTCTGACGG - Intergenic
974212659 4:58800743-58800765 TCTAGAAACAAATTCTCTCGAGG - Intergenic
978994100 4:115128744-115128766 TCTGGATATGAATCCTCTGTTGG - Intergenic
980082742 4:128361834-128361856 TTTGGATACGACATCTCTGGGGG - Intergenic
981488999 4:145320034-145320056 TCTGAACACGGTTTCTATGGTGG - Intergenic
981982209 4:150807474-150807496 TCTGGACACTAAGTCTCCAGTGG + Intronic
985117177 4:186603841-186603863 TCTGGAGAAGAATACTCAGGTGG - Exonic
986178517 5:5372280-5372302 TTTGAACAGGAATTCCCTGGTGG - Intergenic
997433956 5:133860613-133860635 CCTGGAAAGGAATTCTTTGGTGG - Intergenic
997821196 5:137067678-137067700 CCTGCCCACGAATTCTCTGAAGG + Intronic
998429632 5:142059920-142059942 TCTTCATATGAATTCTCTGGGGG + Intergenic
999142343 5:149370918-149370940 TCTGTGCACAAATTCTCTGTAGG - Intergenic
1002790976 6:437139-437161 TCTGGGCACGCATTGTGTGGTGG + Intergenic
1005901927 6:30223976-30223998 TCTGGACACTAATTCCTTGTTGG + Intergenic
1008149949 6:47938282-47938304 ACTGGACATGAATTGTCTAGTGG + Intronic
1018770963 6:166971118-166971140 GCTGGTCAAGAATTCTCAGGAGG - Intergenic
1020424702 7:8051852-8051874 TGTGGATATGAATTCTTTGGTGG + Intronic
1021168912 7:17374149-17374171 ACTGGGCAGGAATTATCTGGAGG - Intergenic
1022219782 7:28301898-28301920 CCTTGAGACAAATTCTCTGGAGG + Intronic
1023184860 7:37522487-37522509 TATGTACACAAAATCTCTGGTGG - Intergenic
1023546862 7:41326836-41326858 CCTGGACAGGAAATTTCTGGAGG + Intergenic
1025035131 7:55589061-55589083 CCTGGCCACCAATTCTCAGGAGG + Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1030095557 7:105895495-105895517 TCTGGAGACCAGTTCTCTGGTGG - Intronic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1052867484 9:33473460-33473482 ACTGGACACAAATTCTGTGGAGG + Intronic
1056069041 9:82966982-82967004 TCTAGACATGAATTCTCAAGGGG + Intergenic
1056630854 9:88291875-88291897 TGTGGACACGAATCACCTGGGGG - Intergenic
1059787605 9:117602876-117602898 TCTGGATACTAATTCTTTGTTGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1186826972 X:13350109-13350131 TTTGGAAACCAGTTCTCTGGGGG - Intergenic
1186929007 X:14367439-14367461 TTTGGATACTAATTCTCTGTTGG - Intergenic
1200194628 X:154239283-154239305 TCTGGACACGAGGTCCTTGGGGG - Intergenic
1200373800 X:155757696-155757718 TCTGAACAAAAAATCTCTGGAGG + Intergenic