ID: 1033476211

View in Genome Browser
Species Human (GRCh38)
Location 7:141695819-141695841
Sequence GACCTATTACAGGTACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033476205_1033476211 15 Left 1033476205 7:141695781-141695803 CCATCTCTGTGTCCTTTCTCATC 0: 1
1: 0
2: 5
3: 79
4: 800
Right 1033476211 7:141695819-141695841 GACCTATTACAGGTACTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1033476207_1033476211 3 Left 1033476207 7:141695793-141695815 CCTTTCTCATCTTGGACCATGAC 0: 1
1: 0
2: 1
3: 10
4: 168
Right 1033476211 7:141695819-141695841 GACCTATTACAGGTACTTACAGG 0: 1
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033476211 Original CRISPR GACCTATTACAGGTACTTAC AGG Intronic
910249396 1:85179964-85179986 GATCTACTACAGGTACTTCAAGG + Intronic
915892313 1:159783384-159783406 GAACTCATACAGGTACGTACAGG - Intergenic
920607775 1:207406873-207406895 GACATATAACAAGTACTTAAAGG - Intergenic
1063164011 10:3443399-3443421 GACCTGTTACAGATACTTTTGGG - Intergenic
1064299774 10:14113026-14113048 GACCTAGTACAGGTTCGGACTGG + Intronic
1066673401 10:37863076-37863098 GACCTATTATAGATAATTAGAGG + Intergenic
1068583987 10:58776075-58776097 GAACAATTACAGGTACATGCAGG - Intronic
1077753110 11:4995622-4995644 CACCTATTCCAGGTAATTAAGGG - Intergenic
1080829733 11:35880442-35880464 GACCTTTTTCATGTGCTTACTGG + Intergenic
1088609720 11:111565493-111565515 GTCCTATTACTGCTACTTACTGG + Intergenic
1091034303 11:132219296-132219318 CACCTCTTACAGGTACTCAAGGG + Intronic
1094300174 12:28955593-28955615 GAACTATTTCAGGGACTTGCTGG - Intergenic
1098040921 12:66353416-66353438 GCCCTATGACAGGCTCTTACAGG - Exonic
1100174943 12:92018875-92018897 GACCTATTACAGGAATATATAGG + Intronic
1102963186 12:117107002-117107024 GACCAATTACCGGAACTTGCAGG + Intergenic
1107310840 13:39075440-39075462 GACCTACAACAGATACTTAAGGG + Intergenic
1114541868 14:23466703-23466725 GACCTGTTTCAGATACTTTCTGG - Intergenic
1115829772 14:37324324-37324346 GAACTTTTTCAGATACTTACTGG + Intronic
1134359499 16:13518065-13518087 GACATATCACAGGTCCTGACTGG - Intergenic
1141642472 16:85349281-85349303 GAGCTATTACAGGGAATTAAGGG + Intergenic
1153013900 18:565880-565902 GCCGTGTTGCAGGTACTTACAGG - Intergenic
1154048503 18:10930633-10930655 GACCTATTTCAGATACTTTTTGG + Intronic
1154234229 18:12588699-12588721 GACCTATTAATTGTCCTTACGGG + Intronic
1157838918 18:50936211-50936233 GACCTATTAAAGTTGCTTATGGG + Intronic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
925176298 2:1786322-1786344 GACCTGTCTCAGATACTTACTGG - Intergenic
933305479 2:80592495-80592517 GAACTATTCCAGGTACTTTTTGG - Intronic
945605149 2:211919772-211919794 GCCCTATTCCAGCTACTTTCTGG - Intronic
948016161 2:234692520-234692542 AACCTAATACATTTACTTACAGG - Intergenic
971104194 4:23504067-23504089 CACCAAATACACGTACTTACAGG - Intergenic
971645378 4:29193275-29193297 GACATATTACAGGTAATTTGAGG + Intergenic
976598228 4:86914312-86914334 GACATATCACAGGTATTGACTGG - Intronic
980826405 4:138078748-138078770 GACCTATTTCAGAGACTTAGTGG - Intergenic
983562373 4:169114101-169114123 CATCTAGTACAGGTCCTTACTGG - Intronic
996495423 5:124149371-124149393 GAACTACCACAGGTACATACCGG - Intergenic
999330234 5:150668906-150668928 GAGCTTTTACTGGTATTTACTGG - Intronic
999864837 5:155689618-155689640 GTCCTATTACAGCTAATTATAGG - Intergenic
1009056716 6:58345087-58345109 GACCTTTAAAAGGTAATTACTGG - Intergenic
1009234526 6:61106485-61106507 GACCTTTGAAAGGTAATTACTGG + Intergenic
1014879831 6:126710001-126710023 GAACTATTGTAGGCACTTACAGG - Intergenic
1025997865 7:66539459-66539481 GACCTGTTTCAGGCACTTTCTGG - Intergenic
1027332846 7:77117489-77117511 GACCAATTAATGGTAATTACAGG - Intergenic
1029782938 7:102753810-102753832 GACCAATTAATGGTAATTACAGG + Intronic
1033476211 7:141695819-141695841 GACCTATTACAGGTACTTACAGG + Intronic
1044584635 8:93858275-93858297 TACCTACAATAGGTACTTACAGG - Intronic
1045137584 8:99237986-99238008 GGCCTATTACAGAAGCTTACTGG - Intronic
1047938331 8:129803281-129803303 GACTTATTCCAGCTACTAACAGG + Intergenic
1049907974 9:236562-236584 GACCTACTACAGGTACTAGTGGG - Intronic
1053891691 9:42699966-42699988 TACTTAGTACAGGTATTTACAGG - Intergenic
1059593178 9:115686515-115686537 GATATTTTATAGGTACTTACAGG + Intergenic
1188295830 X:28447034-28447056 CACTTATTACATGTACTCACCGG - Intergenic
1189212010 X:39291467-39291489 GGCCTATTACTGGTAATTATTGG - Intergenic
1189230385 X:39447765-39447787 GACCTAAGACAAGTACTTATAGG - Intergenic
1190972581 X:55365953-55365975 GACCTAATACTTATACTTACTGG - Intergenic
1192165331 X:68824282-68824304 GCCCTATTTCAGGCTCTTACAGG + Intergenic
1198498501 X:137218542-137218564 GATCTATTACTTGCACTTACAGG + Intergenic
1199372068 X:147061142-147061164 GACCTATTAGAGGTATCCACAGG + Intergenic