ID: 1033477078 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:141701870-141701892 |
| Sequence | CGCTCGGGTGAGGGCCGCGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 138 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 131} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033477078_1033477090 | 14 | Left | 1033477078 | 7:141701870-141701892 | CCGGCGCGGCCCTCACCCGAGCG | 0: 1 1: 0 2: 0 3: 6 4: 131 |
||
| Right | 1033477090 | 7:141701907-141701929 | CCACGAACACGGCCACCACCTGG | 0: 1 1: 0 2: 0 3: 14 4: 128 |
||||
| 1033477078_1033477088 | 3 | Left | 1033477078 | 7:141701870-141701892 | CCGGCGCGGCCCTCACCCGAGCG | 0: 1 1: 0 2: 0 3: 6 4: 131 |
||
| Right | 1033477088 | 7:141701896-141701918 | GTCGAAGGTGACCACGAACACGG | 0: 1 1: 0 2: 0 3: 1 4: 48 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033477078 | Original CRISPR | CGCTCGGGTGAGGGCCGCGC CGG (reversed) | Exonic | ||