ID: 1033477078

View in Genome Browser
Species Human (GRCh38)
Location 7:141701870-141701892
Sequence CGCTCGGGTGAGGGCCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033477078_1033477090 14 Left 1033477078 7:141701870-141701892 CCGGCGCGGCCCTCACCCGAGCG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1033477090 7:141701907-141701929 CCACGAACACGGCCACCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 128
1033477078_1033477088 3 Left 1033477078 7:141701870-141701892 CCGGCGCGGCCCTCACCCGAGCG 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1033477088 7:141701896-141701918 GTCGAAGGTGACCACGAACACGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033477078 Original CRISPR CGCTCGGGTGAGGGCCGCGC CGG (reversed) Exonic