ID: 1033477196

View in Genome Browser
Species Human (GRCh38)
Location 7:141702218-141702240
Sequence GCGGCGGCGTTGGCGCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 8, 3: 77, 4: 485}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033477196_1033477207 3 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477207 7:141702244-141702266 CCGCCGGGTCTGGCGCTGCCCGG 0: 1
1: 0
2: 0
3: 24
4: 187
1033477196_1033477209 5 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477209 7:141702246-141702268 GCCGGGTCTGGCGCTGCCCGGGG 0: 1
1: 0
2: 1
3: 22
4: 209
1033477196_1033477208 4 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477208 7:141702245-141702267 CGCCGGGTCTGGCGCTGCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 229
1033477196_1033477211 16 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477211 7:141702257-141702279 CGCTGCCCGGGGCCCCGCCGCGG 0: 1
1: 0
2: 1
3: 33
4: 346
1033477196_1033477202 -7 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477202 7:141702234-141702256 CCGCCGCCGCCCGCCGGGTCTGG 0: 1
1: 1
2: 4
3: 54
4: 348
1033477196_1033477212 19 Left 1033477196 7:141702218-141702240 CCTGGCCGCGCCAACGCCGCCGC 0: 1
1: 0
2: 8
3: 77
4: 485
Right 1033477212 7:141702260-141702282 TGCCCGGGGCCCCGCCGCGGAGG 0: 1
1: 0
2: 1
3: 37
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033477196 Original CRISPR GCGGCGGCGTTGGCGCGGCC AGG (reversed) Intergenic