ID: 1033477238

View in Genome Browser
Species Human (GRCh38)
Location 7:141702355-141702377
Sequence CCGTGTGCACGTCCGTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033477230_1033477238 12 Left 1033477230 7:141702320-141702342 CCGGCTTCGGGAACCGCGAGCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG No data
1033477233_1033477238 -1 Left 1033477233 7:141702333-141702355 CCGCGAGCCTATTCGGAGGCGCC 0: 1
1: 0
2: 0
3: 2
4: 9
Right 1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG No data
1033477229_1033477238 20 Left 1033477229 7:141702312-141702334 CCGCGGAGCCGGCTTCGGGAACC 0: 1
1: 0
2: 0
3: 9
4: 62
Right 1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG No data
1033477234_1033477238 -8 Left 1033477234 7:141702340-141702362 CCTATTCGGAGGCGCCCGTGTGC 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1033477238 7:141702355-141702377 CCGTGTGCACGTCCGTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033477238 Original CRISPR CCGTGTGCACGTCCGTGTGT GGG Intergenic
No off target data available for this crispr