ID: 1033477265

View in Genome Browser
Species Human (GRCh38)
Location 7:141702546-141702568
Sequence GCAGCTTCTGCCACACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033477265_1033477269 20 Left 1033477265 7:141702546-141702568 CCTGGATGTGTGGCAGAAGCTGC No data
Right 1033477269 7:141702589-141702611 CAGAGGTGCTCTGGCTACCCAGG No data
1033477265_1033477268 11 Left 1033477265 7:141702546-141702568 CCTGGATGTGTGGCAGAAGCTGC No data
Right 1033477268 7:141702580-141702602 GGAGTGAAGCAGAGGTGCTCTGG No data
1033477265_1033477266 -10 Left 1033477265 7:141702546-141702568 CCTGGATGTGTGGCAGAAGCTGC No data
Right 1033477266 7:141702559-141702581 CAGAAGCTGCTTCTAAGCAGAGG No data
1033477265_1033477267 3 Left 1033477265 7:141702546-141702568 CCTGGATGTGTGGCAGAAGCTGC No data
Right 1033477267 7:141702572-141702594 TAAGCAGAGGAGTGAAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033477265 Original CRISPR GCAGCTTCTGCCACACATCC AGG (reversed) Intergenic
No off target data available for this crispr