ID: 1033485338

View in Genome Browser
Species Human (GRCh38)
Location 7:141783594-141783616
Sequence TAAGGTCAACAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033485338 Original CRISPR TAAGGTCAACAGCAGGAGGA GGG Intronic
901436994 1:9253049-9253071 AAAGATCAACATCAGCAGGAGGG + Intronic
902617598 1:17632310-17632332 TGAGGTCAACAGCTGGAGGAGGG - Exonic
903142418 1:21346755-21346777 TGAGGTCAAGGGAAGGAGGAAGG + Intergenic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
905242081 1:36587992-36588014 TAAGGACAACACCAGAAGCAGGG - Intergenic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906304569 1:44708625-44708647 TCAGGACAACAGGAGGCGGAGGG + Intronic
906306607 1:44723947-44723969 TCAGTTGAAGAGCAGGAGGAGGG - Intronic
908020967 1:59898300-59898322 TAAGGTCAAAAGAGGGAGAATGG - Intronic
908807041 1:67942594-67942616 TAAAGTCATCAGAATGAGGATGG - Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
912759178 1:112351347-112351369 TAATCTCAACACCAGGAAGAAGG + Intergenic
914954598 1:152149622-152149644 TAAGCTCAACACCTGGATGATGG - Intergenic
915212549 1:154321309-154321331 TAAGGACAACAGAAGGAGCCAGG - Intronic
915418643 1:155761958-155761980 TCTGGTCAACAGAAGGATGATGG + Intronic
915641445 1:157230244-157230266 TGAGGAGAACAGCAGGAGGAAGG + Intergenic
915667236 1:157456250-157456272 TGAGGAGAACAGCAGGAGGAAGG - Intergenic
916269023 1:162920015-162920037 AAAGGTCCAGAGCAGGAGTATGG + Intergenic
917630162 1:176883709-176883731 TGTGGTCACCAGCAGGATGATGG - Intronic
918246317 1:182662824-182662846 TATGGTAAGCAGCTGGAGGAGGG - Intronic
918276717 1:182959874-182959896 TAAAGTCATCAGCAGCAAGATGG + Intergenic
918707245 1:187680667-187680689 TAAGGTCAACAGCAAAATCAAGG + Intergenic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920255530 1:204651854-204651876 TAGGCCCTACAGCAGGAGGATGG - Intronic
920565138 1:206967094-206967116 GCAGGTCACCAGCAGGAGGGCGG - Exonic
920654256 1:207863978-207864000 GGAGGCCAGCAGCAGGAGGAGGG - Intergenic
921029649 1:211326444-211326466 TTAGGCCAACAGCAAGAGGAGGG + Intergenic
921098646 1:211909423-211909445 TAAGGGCTACAGCAGCAGGGGGG + Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921381861 1:214532653-214532675 TAAAGTCATCAGCAGCAAGATGG - Intronic
923400107 1:233608453-233608475 TAAGGTCAAGGGGAGGAGGAGGG - Intergenic
1063494626 10:6495427-6495449 TTAGGTGAAGAGCAGGAGGAAGG - Intronic
1067465511 10:46495292-46495314 TAAAGCCCCCAGCAGGAGGAAGG + Intergenic
1067621676 10:47889309-47889331 TAAAGCCCCCAGCAGGAGGAAGG - Intergenic
1068958963 10:62847339-62847361 TAAGGGCTGCAGCAGGGGGATGG - Intronic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069381178 10:67844347-67844369 TGAGGACAGCACCAGGAGGATGG - Intergenic
1072247472 10:93556131-93556153 TAAGGTCAACAGTAAGGGGGAGG - Intergenic
1073692830 10:105830082-105830104 TGAGGACAACACCAAGAGGATGG + Intergenic
1074268329 10:111927718-111927740 GAAGGACAACAGAAGGATGAAGG - Intergenic
1076005715 10:126947072-126947094 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076006347 10:126950696-126950718 TGAGGCAAAGAGCAGGAGGAAGG - Intronic
1076526442 10:131115344-131115366 TCATGCCAAGAGCAGGAGGAGGG + Intronic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077229475 11:1452183-1452205 TAAAGCCAGCAGCAGGACGAAGG - Intronic
1077842945 11:5994671-5994693 TAAAGTCATCAGCAGCAAGACGG + Intergenic
1079500574 11:21097015-21097037 CAAGGTCAAGAGCATTAGGAAGG - Intronic
1080827577 11:35861043-35861065 TAAAGTCATCAGCAGCAAGATGG + Intergenic
1081745751 11:45471274-45471296 AAAGGTCAACAGGGGCAGGAAGG + Intergenic
1082629847 11:55529103-55529125 CAAGGACAACAGCATGAGCAAGG - Intergenic
1083118547 11:60489368-60489390 AAAGGCCAACAGGAGAAGGAAGG + Intergenic
1086828266 11:91526707-91526729 TAAAATCAACAGCAGAAAGAGGG - Intergenic
1086932664 11:92709517-92709539 GAAGGTCACCCGTAGGAGGAAGG + Intronic
1088299765 11:108344620-108344642 TGAGATGAACAGCAGTAGGAAGG + Intronic
1089404552 11:118186766-118186788 TTAGGGTAAGAGCAGGAGGATGG - Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1090232005 11:125114040-125114062 TAAAGTCATCAGCAGCAAGACGG - Intergenic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091329403 11:134719382-134719404 TGTGGTCAAGATCAGGAGGAGGG - Intergenic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1093586447 12:20842971-20842993 TCAGGACAGCAGCAGGAAGAGGG - Intronic
1093921854 12:24867572-24867594 AAAGCTCAAAAGCAGGAGCATGG + Intronic
1096188951 12:49602338-49602360 TAAGGTCAGCAGGAGGGAGAAGG - Intronic
1096634641 12:52950381-52950403 TAAAGTCATCAGCAGCAAGACGG - Exonic
1096933027 12:55236922-55236944 AAAGGTGGACAGCTGGAGGAGGG + Intergenic
1099142557 12:78997038-78997060 GGAGGTCAGCAGCAGGAGTATGG + Intronic
1099909661 12:88814093-88814115 TAAGTGCATCATCAGGAGGAAGG + Intergenic
1100583199 12:95955722-95955744 TAGCGTCACCAGCTGGAGGATGG + Intronic
1100649010 12:96564165-96564187 TAAAGTCAACAGAAGTAGGTTGG + Intronic
1101737961 12:107477226-107477248 TACAGGCAACAGCAGGAGGGAGG - Intronic
1101935244 12:109051868-109051890 TAAAGTGAAAAGCAGGAGGTAGG - Intronic
1102834203 12:116038697-116038719 TCAGGTCAACAGCAGCAAGCAGG + Intronic
1104208092 12:126660079-126660101 TAAGGACAGCAGTTGGAGGAGGG + Intergenic
1104572334 12:129935931-129935953 TATGGACAACAGGAGGAGGTAGG - Intergenic
1105899476 13:24743085-24743107 GAAGATGCACAGCAGGAGGAGGG - Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1110880766 13:80569513-80569535 TATGGGCAACAGAAGGAGAAAGG - Intergenic
1110977030 13:81851420-81851442 TAAGGAAAACAGAAGGAAGAAGG + Intergenic
1111485248 13:88889346-88889368 TAAGGTCTACTTGAGGAGGAGGG - Intergenic
1111581676 13:90230861-90230883 TAAGGTCATCAGCAGTAAGACGG - Intergenic
1112932633 13:104761159-104761181 TAAGGTTAGAAGCAGAAGGAAGG + Intergenic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1115662692 14:35512594-35512616 TAAAGTCATCAGCAGCAAGATGG + Intergenic
1115846429 14:37540617-37540639 TAAGGACAAAAGCAGAAGGAGGG - Intronic
1116699713 14:48224534-48224556 TAAGTTGAAGAGCAGAAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117495103 14:56294817-56294839 TAAGTTCAACAGCAAGAGCCAGG - Intronic
1118072718 14:62263378-62263400 AAAGTTCAACATGAGGAGGAGGG - Intergenic
1118428039 14:65688872-65688894 GAAGGTAAACACCAGGAAGAAGG - Intronic
1118941191 14:70339887-70339909 TGAGGTTAAAAGAAGGAGGATGG - Intronic
1118952013 14:70443494-70443516 CAAGGTCATCAGCAGGCTGAGGG + Intergenic
1119378148 14:74211485-74211507 AAAGGCCATCAGCAGGAGAATGG + Intergenic
1120808419 14:88777673-88777695 AAAGTTAAAAAGCAGGAGGATGG + Intronic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1124452384 15:29807485-29807507 TCAGGTAGACAGGAGGAGGAAGG + Intronic
1125006614 15:34824174-34824196 TAAGGCCAAGGGCAAGAGGAGGG + Intergenic
1127906720 15:63381670-63381692 TAAGATCACCAGCAGGAGCACGG + Exonic
1128726815 15:69994049-69994071 TAGGAACAACAGCAGGAGGTGGG + Intergenic
1128805688 15:70529408-70529430 TAAAGTGAACAACAGGAAGATGG + Intergenic
1129927262 15:79375689-79375711 TAAGGACAGCACCAAGAGGATGG + Intronic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1130520228 15:84656315-84656337 TAAGGACAGCACCAGGAGCAGGG + Intronic
1131003903 15:88960222-88960244 TAAAGTCATCAGCAGCAAGACGG - Intergenic
1131278469 15:91002005-91002027 TCAGGACAACAGCTGGAGCAGGG + Intronic
1136595596 16:31247366-31247388 GAGGGTCAAGGGCAGGAGGATGG - Intergenic
1137287753 16:47030510-47030532 AAAGGCCAAGAGCAGGTGGATGG + Intergenic
1137861717 16:51853618-51853640 TAAGGTCAACAAAAAGAGGTTGG + Intergenic
1137929929 16:52577212-52577234 TAAGGTCAGCAGCAGAAAGATGG - Intergenic
1138216857 16:55212195-55212217 TAACATCCACAGCAGGATGAGGG - Intergenic
1139939085 16:70591830-70591852 TCAGGGCAACAGCAGGGGGAAGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143824870 17:9597016-9597038 TCAGTTCAACAGGAGGAGGAGGG - Intronic
1143942456 17:10556778-10556800 TACAGGCATCAGCAGGAGGAAGG - Intergenic
1144017560 17:11210538-11210560 GAAGAACAACTGCAGGAGGAAGG - Intergenic
1147948837 17:44095792-44095814 GAAGGGTAACAGCAGGGGGAGGG + Intronic
1149878133 17:60259158-60259180 TATGGTAAGTAGCAGGAGGAAGG + Intronic
1150459144 17:65332705-65332727 TAAGGTAGACAGCAGGAGTAAGG + Intergenic
1150849159 17:68687861-68687883 TATGGTCAAAAGCTGGAAGATGG - Intergenic
1150976882 17:70097456-70097478 GGAGGTCAGGAGCAGGAGGATGG + Intronic
1153000428 18:450455-450477 TAATGGCCAGAGCAGGAGGAAGG - Intronic
1153546689 18:6213914-6213936 TAAGGTCAATATCAGAAAGAAGG - Intronic
1155907706 18:31472287-31472309 ACAGGTCAACAGCAGAAGGGGGG - Exonic
1158229969 18:55243496-55243518 TAAGATCAAAAGCAGAAGAAAGG + Intronic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159553863 18:69924663-69924685 AAAGGGCAACAGTAGGATGAAGG + Intronic
1159863151 18:73672982-73673004 TAATGTCAAGTGGAGGAGGACGG - Intergenic
1163986967 19:20962550-20962572 TAAAGTCATCAGCAGCAAGATGG - Intergenic
1164018480 19:21274536-21274558 TGAGGGGAAGAGCAGGAGGAGGG - Intronic
1166706227 19:44909341-44909363 TAGGGTCCACCCCAGGAGGACGG - Exonic
925580908 2:5409591-5409613 TAAGGTCAAAAGGAGCAGGTTGG - Intergenic
925608766 2:5685468-5685490 TAAGCACAAGTGCAGGAGGAGGG - Intergenic
926618865 2:15028711-15028733 GAATGTCAACATCTGGAGGAAGG - Intergenic
932067668 2:68583678-68583700 TAAGGGCAAAAGGAAGAGGAGGG - Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933862929 2:86487990-86488012 TAAGGGCAATAGGAAGAGGATGG - Intronic
935241413 2:101181519-101181541 TGAGGACAACACCAAGAGGATGG + Intronic
936245758 2:110825903-110825925 TGAGCACATCAGCAGGAGGAAGG + Intronic
937510646 2:122591280-122591302 GAAGGTCTGCAGCAGCAGGAAGG - Intergenic
938608276 2:132919564-132919586 CAAGATCAACAGCGGGATGATGG + Intronic
938910352 2:135879718-135879740 TAACTTCCACAACAGGAGGAGGG + Intergenic
939427268 2:142055658-142055680 TAAGGTCAACAGTTGGAGAATGG - Intronic
941125343 2:161577801-161577823 TAAGTTCAACAGCAGAATGGAGG - Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
944855736 2:203765094-203765116 TAAAGTCATCAGCAGCAAGATGG + Intergenic
945333907 2:208569532-208569554 TAAGAATAACAACAGGAGGATGG + Intronic
945453971 2:210027340-210027362 TATCTTCAACAGCTGGAGGATGG - Exonic
945868212 2:215200365-215200387 TAAGAACATCAGGAGGAGGAAGG + Intergenic
947448788 2:230185889-230185911 TAAAGTCAATAGTAGAAGGAGGG - Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947753253 2:232543593-232543615 GATGGTCACCACCAGGAGGAAGG - Exonic
947931727 2:233970311-233970333 GTAGGCAAACAGCAGGAGGAAGG - Exonic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948556304 2:238813760-238813782 GGAGGAGAACAGCAGGAGGAAGG - Intergenic
1168985100 20:2041146-2041168 TAACATGAACAGCATGAGGAGGG - Intergenic
1170359721 20:15532781-15532803 TAAGGACAACACCAGGATGGGGG - Intronic
1170865910 20:20157419-20157441 TAAGGTCAACAGTAGGTTAATGG + Intronic
1171140093 20:22733597-22733619 TAAAGTCATCAGCAGCAAGATGG + Intergenic
1171188300 20:23139199-23139221 TAAGGCCAACAGAAAGAGAATGG - Intergenic
1172047973 20:32094321-32094343 AAATGTCCATAGCAGGAGGATGG + Intronic
1175014557 20:55775341-55775363 TAAGATAAGCATCAGGAGGATGG - Intergenic
1178100833 21:29266893-29266915 TAAGATCAGTTGCAGGAGGATGG - Intronic
1178355772 21:31909579-31909601 TTAGCTCAGCAGCAGGAGGGTGG + Intronic
1178527537 21:33344384-33344406 TAAGGTCAAGGGCAGGAGCTGGG + Intronic
1179652137 21:42818438-42818460 GAAGCGCAGCAGCAGGAGGAGGG + Intergenic
1179958388 21:44753964-44753986 AAAGGTCTTCAGCATGAGGAGGG - Intergenic
1180887570 22:19257992-19258014 TAAAGTCAGCAGCAGCAAGATGG - Intronic
1181092487 22:20483614-20483636 TAAAGTCATCAGCAGCAAGACGG + Intronic
1183978220 22:41525345-41525367 CAAGGTCAGCAGCATGGGGACGG + Exonic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
1184448338 22:44567430-44567452 TAAAGTCATCAGCAGCAAGATGG - Intergenic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949421824 3:3873832-3873854 TAGGGTCAAGGGCAGGAGCAAGG - Intronic
950403341 3:12788180-12788202 TAAAGTCATCAGCAGCAAGATGG + Intergenic
950880195 3:16317057-16317079 TCAGGACAGCAGCAGGAGGGTGG - Exonic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
953075841 3:39569648-39569670 TCAGGTCAACAGGAAGGGGAAGG + Intergenic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
954153323 3:48670612-48670634 TAAGGCCAACCCCAGGATGAGGG - Intergenic
954168862 3:48783444-48783466 TAAGGTCAACAGCTGTAGGAAGG - Intronic
956774030 3:72550167-72550189 AAAGGACAAGAGGAGGAGGAGGG - Intergenic
957308972 3:78494755-78494777 TACGGGCAACAGCAGGAACAGGG - Intergenic
957610383 3:82458461-82458483 TTAGGAAAACAGCATGAGGATGG - Intergenic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
960611909 3:119562509-119562531 CAAGGTCAAGAGCAGAAAGATGG - Intergenic
962105424 3:132383759-132383781 TAATGCCAGCTGCAGGAGGAAGG - Intergenic
962324523 3:134422384-134422406 TGAGGACAACACCAGGGGGATGG - Intergenic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
964483381 3:157163451-157163473 TAAAGTCATCAGCAGCAAGATGG + Intergenic
964531866 3:157677054-157677076 TACTGACAAAAGCAGGAGGAAGG + Intronic
965325581 3:167299939-167299961 AAAGGTGAAAAGCAGGTGGAGGG - Intronic
970031046 4:11675140-11675162 AATTGTCAATAGCAGGAGGAAGG + Intergenic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
970628101 4:17912168-17912190 TAAAGTCATCAGCAGCAAGACGG - Intronic
970789536 4:19840293-19840315 AAAGTTCAACATCAGGATGATGG - Intergenic
971001220 4:22324711-22324733 TAAGGGTCACACCAGGAGGATGG + Intergenic
971179976 4:24320867-24320889 CAAGGTCAACAGCTGGAAAATGG + Intergenic
971444707 4:26730971-26730993 TAAGGAGTACAGCCGGAGGAGGG + Intronic
972409507 4:38778786-38778808 TATGCTCAACAGAAAGAGGATGG + Intronic
973608094 4:52607678-52607700 TGAGGACAGCACCAGGAGGATGG - Intronic
975636872 4:76458990-76459012 ACAGGTCAACAGCAGCAGGGGGG + Intronic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
982295883 4:153828667-153828689 TTAGGTCATTGGCAGGAGGAAGG - Intergenic
984565413 4:181324190-181324212 GAAGGTCAACACAAGGTGGAGGG - Intergenic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
985674319 5:1222998-1223020 AAAGGTCAACACCAAGGGGAAGG - Exonic
986019492 5:3787890-3787912 CAAGGTCAACTGGAGGAGAAAGG + Intergenic
989314942 5:40067120-40067142 TAAAGTCATCAGCAGCAAGACGG - Intergenic
990050946 5:51500106-51500128 AAAGGTCAGGAGCAGGAGCAAGG - Intergenic
990941043 5:61203509-61203531 TTAGGTCAACAGCTGAGGGAGGG - Intergenic
991106228 5:62844927-62844949 TAAGCTCAATAGCAGAAGGGAGG - Intergenic
991504301 5:67308162-67308184 TTCTGTCAACAGTAGGAGGAAGG - Intergenic
993552511 5:89291305-89291327 TACAATCATCAGCAGGAGGAAGG + Intergenic
995457403 5:112366768-112366790 AAAGGTGCACTGCAGGAGGAAGG + Intronic
996223016 5:120955788-120955810 TAAGGTATACATCAGGAAGAGGG + Intergenic
996597930 5:125226695-125226717 AAATGTCAACTGCATGAGGATGG - Intergenic
996617037 5:125454280-125454302 AAAGGGAAACAGCAGGATGAAGG + Intergenic
996653958 5:125915917-125915939 GAAGATCAAGAGCAGTAGGAGGG + Intergenic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997431731 5:133845467-133845489 TCAGGGCAACAGCAGGCCGAGGG - Intergenic
997500073 5:134366988-134367010 TAAAGTCAACAGCGGGACGTGGG - Exonic
1000075513 5:157781423-157781445 AAAGGTCAACAGCAGGAGATGGG - Intergenic
1001250227 5:170141452-170141474 TAAAGTCATCAGCAGCAAGACGG + Intergenic
1002787260 6:411871-411893 TGAGGTCAACAGCAGACGTACGG - Intergenic
1004017296 6:11743881-11743903 TAAGGTCACCAGCTGGAAGTGGG - Intronic
1004843451 6:19613201-19613223 TAAAGTCATCAGCAGCAAGACGG - Intergenic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1006312242 6:33268967-33268989 TAATGTCCATAGCAGGTGGATGG - Intronic
1007289294 6:40773128-40773150 CAAGGTCAACAGCAAGTTGAGGG + Intergenic
1008280380 6:49589030-49589052 TGAGATCAAGAGCAAGAGGAGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1012133597 6:95526742-95526764 TTAGGACAACTGCAGGAGAAAGG + Intergenic
1013493828 6:110677797-110677819 TATGGTCTAATGCAGGAGGAGGG - Intronic
1013714140 6:112937480-112937502 TAAGGACAGCATCAAGAGGATGG - Intergenic
1016668899 6:146677673-146677695 TAAGTTCAGCAGGAGAAGGAAGG - Intronic
1017018983 6:150125071-150125093 TAAGGACAGCACCAAGAGGATGG - Intergenic
1019087410 6:169491748-169491770 TAAGCTCAACAGCAGGTCCAAGG + Intronic
1019629482 7:2040528-2040550 TAAGGTCAGCAGCAGAATGGAGG - Intronic
1021781461 7:24110820-24110842 AATGGTCAACAGCAGGTGTAAGG + Intergenic
1022186592 7:27975238-27975260 TAAGGGCAGGAGCAAGAGGAGGG + Intronic
1022708288 7:32827220-32827242 TGAGGTCAAAAGCAGAAGGCAGG - Intergenic
1022830522 7:34060794-34060816 TAAGGACAACTGCATGTGGAGGG + Intronic
1022914886 7:34938272-34938294 TGAGGTCAAAAGCAGAAGGCAGG + Intronic
1023193335 7:37607177-37607199 TAAGGCCACCAGCTGGAGAAGGG - Intergenic
1023831093 7:44039390-44039412 AAATGTCAACAGCAGGCGGTGGG + Intergenic
1023905969 7:44521756-44521778 TAAAGGCGGCAGCAGGAGGACGG + Exonic
1024613144 7:51084259-51084281 TAAGGTCTGCAGCTGCAGGAGGG - Intronic
1026495269 7:70896422-70896444 TAAGGTAAGAAGCAGGTGGACGG - Intergenic
1026894059 7:73999964-73999986 CAAGGTCAACAGCACGAGGCGGG + Intergenic
1027601402 7:80245520-80245542 TACGGTCTTCAGGAGGAGGAAGG - Intergenic
1030956909 7:115864240-115864262 GAAGTACAGCAGCAGGAGGATGG - Intergenic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034132985 7:148738195-148738217 TAAAGTGAGCAGCAGGATGACGG - Intronic
1034986371 7:155517986-155518008 TCAGGTGAGGAGCAGGAGGAGGG + Intronic
1035246627 7:157566563-157566585 GCAGGTCAAGAACAGGAGGAGGG + Intronic
1035937522 8:3858249-3858271 TAAAGTCCACAGAATGAGGATGG + Intronic
1036468080 8:9021610-9021632 TAGGGTTAACTCCAGGAGGAAGG - Intronic
1037517970 8:19652695-19652717 TAAGTGGAACAGCAGGAGGTGGG - Intronic
1037607391 8:20449166-20449188 AATGGTCAACAGCAGGTGGAAGG - Intergenic
1039166941 8:34692399-34692421 GAAATTCAAAAGCAGGAGGAGGG - Intergenic
1039780232 8:40777790-40777812 TAAGGTCAACAGCTGCAACAAGG + Intronic
1040980822 8:53244761-53244783 TAAGGAGAACAGAAAGAGGATGG + Intronic
1043861082 8:85317877-85317899 CATGGTCAATAGCAGTAGGAGGG - Intergenic
1044492087 8:92831123-92831145 CAAGTCCAACAGCAGTAGGATGG + Intergenic
1044661423 8:94594788-94594810 TCAGGTCAACAGCAGGTACATGG - Intergenic
1045329760 8:101145387-101145409 TAAGGTCAAGAAGAGGAGAATGG + Intergenic
1046757067 8:117982985-117983007 TTAAGTCAAGAGCAGGAGAATGG - Intronic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1049139204 8:140936394-140936416 TAAGGTAAAACACAGGAGGAGGG + Intronic
1049457914 8:142703322-142703344 GGAGGCCAGCAGCAGGAGGATGG - Exonic
1049743323 8:144251278-144251300 AAAGGTCAACAGTACCAGGAAGG - Intronic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1058586483 9:106512080-106512102 TAGGCTCAACAGCAGAATGAAGG + Intergenic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1061388161 9:130302659-130302681 TCAGGACAACAGGACGAGGATGG + Intronic
1061390168 9:130313258-130313280 TCAGCTCAACAGCAGGAAGCGGG - Intronic
1186393997 X:9189504-9189526 TAAGAGCAGCAGCTGGAGGAAGG - Intergenic
1188532907 X:31162318-31162340 GAAGGCCAACAGGAGGATGAGGG + Intronic
1189928633 X:45983832-45983854 TAAAGTCATCAGCAGCAAGACGG - Intergenic
1193271623 X:79535857-79535879 TAGGGGCAATAGCAAGAGGAGGG + Intergenic
1194321977 X:92460134-92460156 TAAAGTCATCAGCAGCAAGACGG - Intronic
1195883574 X:109617979-109618001 CTAGGTCAATAGCTGGAGGAGGG + Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1200020551 X:153201749-153201771 TGAGGTGGACAGTAGGAGGAGGG - Intergenic
1200050427 X:153426792-153426814 TGAGGACAACACCAAGAGGATGG - Intergenic
1200630144 Y:5573611-5573633 TAAAGTCATCAGCAGCAAGACGG - Intronic
1201622039 Y:15970157-15970179 TAAGGGCACCAGGTGGAGGAGGG - Intergenic
1201941089 Y:19460910-19460932 TAAGGTCAAAGGCAGGATGAAGG + Intergenic