ID: 1033486976

View in Genome Browser
Species Human (GRCh38)
Location 7:141800151-141800173
Sequence CTGTCTATCCACAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033486967_1033486976 13 Left 1033486967 7:141800115-141800137 CCCTAGAGAGCTCCTTTGCCCTT No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486968_1033486976 12 Left 1033486968 7:141800116-141800138 CCTAGAGAGCTCCTTTGCCCTTT No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486966_1033486976 27 Left 1033486966 7:141800101-141800123 CCTTGTAAAAGAGACCCTAGAGA No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486965_1033486976 28 Left 1033486965 7:141800100-141800122 CCCTTGTAAAAGAGACCCTAGAG No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486971_1033486976 1 Left 1033486971 7:141800127-141800149 CCTTTGCCCTTTGGGAAAAGATA No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486973_1033486976 -6 Left 1033486973 7:141800134-141800156 CCTTTGGGAAAAGATAGCTGTCT No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data
1033486972_1033486976 -5 Left 1033486972 7:141800133-141800155 CCCTTTGGGAAAAGATAGCTGTC No data
Right 1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033486976 Original CRISPR CTGTCTATCCACAAGGAAGT GGG Intergenic
No off target data available for this crispr