ID: 1033490694

View in Genome Browser
Species Human (GRCh38)
Location 7:141840823-141840845
Sequence TAGCTTAACACTAGAAAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033490687_1033490694 8 Left 1033490687 7:141840792-141840814 CCAAGGCACATGTGTGCCTTAAC No data
Right 1033490694 7:141840823-141840845 TAGCTTAACACTAGAAAAGTGGG 0: 1
1: 1
2: 0
3: 12
4: 105
1033490688_1033490694 -8 Left 1033490688 7:141840808-141840830 CCTTAACCCACCCTATAGCTTAA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1033490694 7:141840823-141840845 TAGCTTAACACTAGAAAAGTGGG 0: 1
1: 1
2: 0
3: 12
4: 105
1033490686_1033490694 14 Left 1033490686 7:141840786-141840808 CCTTCTCCAAGGCACATGTGTGC No data
Right 1033490694 7:141840823-141840845 TAGCTTAACACTAGAAAAGTGGG 0: 1
1: 1
2: 0
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033490694 Original CRISPR TAGCTTAACACTAGAAAAGT GGG Intronic