ID: 1033490695

View in Genome Browser
Species Human (GRCh38)
Location 7:141840837-141840859
Sequence AAAAGTGGGCTCAGCCTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033490691_1033490695 -4 Left 1033490691 7:141840818-141840840 CCCTATAGCTTAACACTAGAAAA 0: 1
1: 0
2: 1
3: 21
4: 189
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490688_1033490695 6 Left 1033490688 7:141840808-141840830 CCTTAACCCACCCTATAGCTTAA 0: 1
1: 0
2: 1
3: 7
4: 77
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490690_1033490695 -1 Left 1033490690 7:141840815-141840837 CCACCCTATAGCTTAACACTAGA 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490687_1033490695 22 Left 1033490687 7:141840792-141840814 CCAAGGCACATGTGTGCCTTAAC No data
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490689_1033490695 0 Left 1033490689 7:141840814-141840836 CCCACCCTATAGCTTAACACTAG 0: 1
1: 0
2: 1
3: 2
4: 59
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490686_1033490695 28 Left 1033490686 7:141840786-141840808 CCTTCTCCAAGGCACATGTGTGC No data
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1033490692_1033490695 -5 Left 1033490692 7:141840819-141840841 CCTATAGCTTAACACTAGAAAAG 0: 1
1: 0
2: 2
3: 13
4: 149
Right 1033490695 7:141840837-141840859 AAAAGTGGGCTCAGCCTATCCGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033490695 Original CRISPR AAAAGTGGGCTCAGCCTATC CGG Intronic