ID: 1033491570

View in Genome Browser
Species Human (GRCh38)
Location 7:141848593-141848615
Sequence CAGGCTACAGACTCTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033491570_1033491579 -4 Left 1033491570 7:141848593-141848615 CCAGGAAAAGAGTCTGTAGCCTG No data
Right 1033491579 7:141848612-141848634 CCTGGTTTGGGAGGGTGAAGGGG No data
1033491570_1033491576 -6 Left 1033491570 7:141848593-141848615 CCAGGAAAAGAGTCTGTAGCCTG No data
Right 1033491576 7:141848610-141848632 AGCCTGGTTTGGGAGGGTGAAGG No data
1033491570_1033491577 -5 Left 1033491570 7:141848593-141848615 CCAGGAAAAGAGTCTGTAGCCTG No data
Right 1033491577 7:141848611-141848633 GCCTGGTTTGGGAGGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033491570 Original CRISPR CAGGCTACAGACTCTTTTCC TGG (reversed) Intergenic
No off target data available for this crispr