ID: 1033491844

View in Genome Browser
Species Human (GRCh38)
Location 7:141852061-141852083
Sequence ACATTAAAATCACTGCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033491844_1033491846 10 Left 1033491844 7:141852061-141852083 CCTTAAGGCAGTGATTTTAATGT No data
Right 1033491846 7:141852094-141852116 TTATAGTCTAACTTGGCTCTTGG No data
1033491844_1033491845 3 Left 1033491844 7:141852061-141852083 CCTTAAGGCAGTGATTTTAATGT No data
Right 1033491845 7:141852087-141852109 TAATTTATTATAGTCTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033491844 Original CRISPR ACATTAAAATCACTGCCTTA AGG (reversed) Intergenic