ID: 1033491844 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:141852061-141852083 |
| Sequence | ACATTAAAATCACTGCCTTA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033491844_1033491846 | 10 | Left | 1033491844 | 7:141852061-141852083 | CCTTAAGGCAGTGATTTTAATGT | No data | ||
| Right | 1033491846 | 7:141852094-141852116 | TTATAGTCTAACTTGGCTCTTGG | No data | ||||
| 1033491844_1033491845 | 3 | Left | 1033491844 | 7:141852061-141852083 | CCTTAAGGCAGTGATTTTAATGT | No data | ||
| Right | 1033491845 | 7:141852087-141852109 | TAATTTATTATAGTCTAACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033491844 | Original CRISPR | ACATTAAAATCACTGCCTTA AGG (reversed) | Intergenic | ||