ID: 1033492348

View in Genome Browser
Species Human (GRCh38)
Location 7:141855716-141855738
Sequence CTCTGTGTGGGGAAGGCATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033492348_1033492355 -10 Left 1033492348 7:141855716-141855738 CCGTATGCCTTCCCCACACAGAG No data
Right 1033492355 7:141855729-141855751 CCACACAGAGGCAGGAACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033492348 Original CRISPR CTCTGTGTGGGGAAGGCATA CGG (reversed) Intergenic
No off target data available for this crispr