ID: 1033495916

View in Genome Browser
Species Human (GRCh38)
Location 7:141895796-141895818
Sequence ATTGTATGTAGGGGGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033495916_1033495923 9 Left 1033495916 7:141895796-141895818 CCTTTAGACCCCCTACATACAAT No data
Right 1033495923 7:141895828-141895850 CAACATTGTTTTTGAATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033495916 Original CRISPR ATTGTATGTAGGGGGTCTAA AGG (reversed) Intergenic
No off target data available for this crispr