ID: 1033496789

View in Genome Browser
Species Human (GRCh38)
Location 7:141906874-141906896
Sequence ACACATGCATTTTCTCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 3, 1: 9, 2: 32, 3: 122, 4: 398}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033496787_1033496789 3 Left 1033496787 7:141906848-141906870 CCTTACACCAGAATGAAGCATAT No data
Right 1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG 0: 3
1: 9
2: 32
3: 122
4: 398
1033496788_1033496789 -4 Left 1033496788 7:141906855-141906877 CCAGAATGAAGCATATTTAACAC No data
Right 1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG 0: 3
1: 9
2: 32
3: 122
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033496789 Original CRISPR ACACATGCATTTTCTCTGTA AGG Intergenic
900829365 1:4954533-4954555 ACAAATGCAATATATCTGTATGG + Intergenic
901448313 1:9321308-9321330 ACACACGGGCTTTCTCTGTAAGG - Intronic
904030848 1:27532551-27532573 ACACAGGCATTTTCTCCCTGCGG + Intergenic
904845424 1:33409974-33409996 CCTCATGTATTTTCTCTGGAAGG + Intronic
904987037 1:34560218-34560240 ACACATGTAATTTCTCTGGAAGG - Intergenic
905286957 1:36887169-36887191 TCACATTGATTTTCTGTGTATGG - Intronic
905696552 1:39978847-39978869 ACATATGTATTTTCTCTGTAAGG - Intergenic
905903621 1:41599238-41599260 TCACATTCGTTTTCTGTGTATGG - Intronic
906428885 1:45738427-45738449 ACATAGGTATTTTCTCTGTAAGG - Intronic
906555027 1:46703562-46703584 ACACATGTATTTTTTCCATAGGG + Intronic
906832659 1:49049708-49049730 ATACTTGTATTTTCTCTGTAAGG - Intronic
907845031 1:58197346-58197368 AGATATCCATTTTCTCTTTATGG + Intronic
908048109 1:60194636-60194658 CCACATACTTTTTCTTTGTAAGG - Intergenic
908439299 1:64137400-64137422 GCACATGCAATCCCTCTGTATGG - Exonic
908567919 1:65377680-65377702 ACACATTGAGTTTCTCTGTCTGG - Intronic
908910148 1:69063714-69063736 TCAAAAGCCTTTTCTCTGTAAGG + Intergenic
909398236 1:75194707-75194729 ACACATTCATTGCCTGTGTAAGG + Intergenic
909583899 1:77267625-77267647 ACACCTTGTTTTTCTCTGTATGG - Intergenic
909652527 1:77991814-77991836 ACACCTGAATTTTCTCTGTAAGG - Intronic
909791453 1:79683466-79683488 TAACATGAATTTTCTCTGTGAGG - Intergenic
909906902 1:81208244-81208266 ACTGATTCATTCTCTCTGTAAGG + Intergenic
910114404 1:83716427-83716449 TCACAAGGATCTTCTCTGTAAGG + Intergenic
910593766 1:88956090-88956112 ACACACATATTTTCTCCGTAAGG + Intronic
911203743 1:95072446-95072468 AAACATGCAGTTTCCCCGTATGG - Intronic
911926691 1:103841709-103841731 ACACATGGCTTTTCTTTGCATGG - Intergenic
911943439 1:104075617-104075639 ACAGATCGATTTTCTCAGTAGGG + Intergenic
912657206 1:111497515-111497537 AGACATTTATTTTCACTGTACGG + Intronic
913485721 1:119331380-119331402 ACAGAAGTATTTTCTGTGTAAGG + Intergenic
918201106 1:182267804-182267826 ACACATGTATTTTCTCCATAAGG + Intergenic
918409735 1:184245865-184245887 TCACATGCATTTTCTCTTGATGG - Intergenic
918832027 1:189410946-189410968 ACAAATTCATGTTCTTTGTAGGG - Intergenic
918904020 1:190467077-190467099 AATAATGCATTTTCTATGTAGGG - Intronic
919107422 1:193171002-193171024 ACACAGGGCTTTTCTCTGGAGGG - Intronic
919486419 1:198153535-198153557 GTAAATGCAATTTCTCTGTAAGG - Intergenic
920265452 1:204718308-204718330 ACACAGGTATTTTCTTTGTGAGG - Intergenic
920742277 1:208592424-208592446 ACACAGGTATTTTCTCTGTAAGG + Intergenic
921080396 1:211734535-211734557 ACATACGTATTTTCTCTGTCGGG + Intergenic
921159246 1:212461596-212461618 ATACACGTGTTTTCTCTGTATGG + Intergenic
921489009 1:215751395-215751417 ACACATACTTTTTCTCACTAAGG - Intronic
921548423 1:216501944-216501966 ACAAATGCATTATCTTTTTAAGG - Intergenic
922076184 1:222247239-222247261 CAACAAGCATTTTGTCTGTATGG + Intergenic
922713679 1:227853455-227853477 ACACATATATTTACTCTTTAGGG + Intergenic
923080426 1:230648157-230648179 GCACATGCATTTTATCAGTAGGG + Intronic
923128608 1:231055317-231055339 ACACACACATTTTCTCTATGAGG - Intergenic
923143176 1:231178806-231178828 ACACCAGCATTTTGTGTGTAAGG - Intronic
923321127 1:232834587-232834609 GCAGAAGTATTTTCTCTGTAAGG - Intergenic
924070504 1:240273616-240273638 ACACATTCATGTTCTGTGTATGG + Intronic
924078398 1:240365851-240365873 ACACATGTATTTTCTCCATAAGG + Intronic
924623335 1:245681027-245681049 ACACATGGATTTTCTCCATAAGG - Intronic
924693373 1:246374581-246374603 AAACATGCATTTTCTCTGTGAGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063080034 10:2759133-2759155 ACACACACATTTCCTCTGTGTGG - Intergenic
1063374225 10:5544040-5544062 ACACATACAATTTTTCTGTGTGG + Intergenic
1063652388 10:7950922-7950944 ACACATGCATTTTCTCTATGAGG - Intronic
1064129886 10:12700148-12700170 ACACACATATTTTCTCTGTAAGG + Intronic
1064294260 10:14064269-14064291 ACACATGCATTCTTTCAGCAAGG - Intronic
1064531568 10:16315622-16315644 ACACATGTATTCTCTCTCTAAGG + Intergenic
1065701307 10:28428207-28428229 ACACATACATTTTCTCCATAAGG - Intergenic
1065988810 10:30986272-30986294 TCACATGCATTTTCTCCTTAAGG + Intronic
1066066611 10:31765535-31765557 ACCCAGGCCTTTTCTCTGTGTGG - Intergenic
1066159269 10:32711314-32711336 ACATATGCATTTTCATTGTTTGG + Intronic
1068159346 10:53243612-53243634 ACAAATGGATTTTCTTTGTAAGG - Intergenic
1068751851 10:60603064-60603086 ACACAAGCATTTGCTGAGTAGGG - Intronic
1068813114 10:61279151-61279173 ACAAATGCAATTTGTCTGTCAGG + Intergenic
1069124460 10:64612878-64612900 TCACATACTTTTTCTATGTACGG - Intergenic
1069918500 10:71801816-71801838 ACACATGCATGTGCTGTGTTGGG + Intronic
1070248812 10:74755701-74755723 ACACATGTATTTTCTCCGGAAGG - Intergenic
1070442204 10:76457604-76457626 ACACATGGATTTTCTCTACAGGG - Intronic
1071194577 10:83142905-83142927 ACACATGAAATTTCACTGTGTGG - Intergenic
1071473161 10:86001594-86001616 ACAGATGCCCTTTCTCTGCAAGG - Intronic
1071811005 10:89180710-89180732 ATACATGTATTTTCTCCATAAGG - Intergenic
1071914436 10:90275675-90275697 TCAAATGCATTTTCTCGGAATGG - Intergenic
1072028022 10:91483903-91483925 ACATACATATTTTCTCTGTAGGG + Intronic
1072477018 10:95771745-95771767 TCAGATACATTTTCTCTTTAGGG + Intronic
1072845339 10:98823899-98823921 AAGCATGCATTTTTTCTGTTTGG - Intronic
1073745487 10:106463759-106463781 ACACACATATTTTCTCTGGAAGG + Intergenic
1074185959 10:111099631-111099653 ACACATGGCTGTTCTCTGTTAGG + Intergenic
1074332346 10:112527672-112527694 ACAGAAGCAGTTCCTCTGTATGG - Intronic
1074807664 10:117069774-117069796 ACACATGCCATTTTTCTGTTGGG + Intronic
1074955329 10:118383255-118383277 ATACATGCATTTCCTCGGTGAGG - Intergenic
1075033059 10:119039726-119039748 ATACATGTATTTTCTCCTTAAGG - Intronic
1075168975 10:120095628-120095650 TCACATGCATTTTCTCTTTGTGG + Intergenic
1075898410 10:126018487-126018509 ACTCATCCATTATTTCTGTATGG - Intronic
1077706484 11:4491462-4491484 ACACATACATGTTATCTTTATGG - Intergenic
1077955134 11:7010098-7010120 ACACATGCTTATTGTCTTTATGG - Intronic
1078195444 11:9133330-9133352 ACCCATGCATTTTTCCTGTAGGG - Intronic
1078583914 11:12563579-12563601 ACACATATATTTGCTCTGTAAGG + Intergenic
1079299465 11:19264792-19264814 ACACACATATTTTCTCTATAAGG - Intergenic
1079403673 11:20126848-20126870 CCACATACATTTTCACTGTAGGG - Intergenic
1080774743 11:35375314-35375336 ACACATTCAGCTTCTCTGGAAGG - Intronic
1080820591 11:35802466-35802488 AAACATGCCTGTGCTCTGTAAGG - Intronic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1081236877 11:40657376-40657398 ACAGAGCCATGTTCTCTGTAGGG + Intronic
1082293831 11:50413669-50413691 ACACTTGGGTTTTCTATGTAAGG - Intergenic
1084636121 11:70394024-70394046 ACACCTGTTTTCTCTCTGTACGG - Intergenic
1084716079 11:70874486-70874508 GCACATGCCCTTCCTCTGTATGG + Intronic
1084724335 11:70930967-70930989 ACAAATGCATTTTCTGGGTACGG + Intronic
1085654080 11:78296448-78296470 ATACATGTATTTTCTCAGTAAGG + Intronic
1086385619 11:86304291-86304313 ACACACATATTTTCTCTGTAAGG + Intronic
1086502518 11:87467957-87467979 ACACACACACTTTCTCTCTAAGG - Intergenic
1086721276 11:90124412-90124434 ACAGAAACATTTGCTCTGTAGGG - Intergenic
1087181603 11:95147653-95147675 ACAGATGCATTTCCCCTGCATGG - Intergenic
1087905440 11:103690955-103690977 TAACATACATTTTATCTGTAAGG - Intergenic
1087962538 11:104369825-104369847 ACACATCTATTTTCTCCGTAAGG + Intergenic
1087976453 11:104554726-104554748 ACACATATATTTTCTCTGCAAGG - Intergenic
1088390051 11:109304318-109304340 ACATATGTGTTTTCTCTGTAAGG - Intergenic
1090164555 11:124533727-124533749 ACACAAGCAATTTCTTTGTGTGG + Intergenic
1091166869 11:133486006-133486028 ACACACATATTTTCTCTGTAAGG - Intronic
1091467848 12:701085-701107 ACACACATATTTTCTCCGTAAGG - Intergenic
1091714621 12:2768026-2768048 CCAAATGCCTTTTCTCTGTAGGG + Intergenic
1093863280 12:24194360-24194382 ACACCTGCATGTTGTGTGTATGG - Intergenic
1093902297 12:24649881-24649903 ACATATGCATTTTCACTATAAGG + Intergenic
1094094025 12:26683473-26683495 GCACAAGTATTTTCTTTGTAAGG - Intronic
1094406360 12:30120731-30120753 ACACATGTATTTTCTCCAAAAGG + Intergenic
1095305510 12:40634337-40634359 GCAAATGCATTATATCTGTATGG + Intergenic
1095463438 12:42465733-42465755 ATACATGTCTTTTCTCTGTAAGG - Intronic
1095882646 12:47154611-47154633 ACACATACATTTACTCTTTTAGG - Intronic
1096339884 12:50788971-50788993 ACACATGTATTTCCTCCATAAGG - Intronic
1096399429 12:51292937-51292959 ATACATGTATTTTCTCTGGAAGG - Intronic
1096483289 12:51957809-51957831 TAACATGTATTTTCTCTGTGAGG + Intronic
1097283228 12:57858676-57858698 ACACATGAATTATCTCTCTGAGG + Intergenic
1097349220 12:58529391-58529413 ACACATGTATTTTCTCTGTAAGG - Intergenic
1097402388 12:59145134-59145156 ACACATGCATTTTTTATTTGAGG - Intergenic
1097647827 12:62258408-62258430 AAAAATGCATTTTCTCTTAAGGG + Intronic
1098697365 12:73576055-73576077 CTATATGCTTTTTCTCTGTATGG - Intergenic
1098873337 12:75841047-75841069 ACAAATGCAGTTTCTCTGAGAGG - Intergenic
1098988600 12:77040260-77040282 ACACATGTATATTCTCCATAAGG + Intronic
1100212873 12:92416383-92416405 ACGCATGCATTTTATATGTGTGG + Intergenic
1100397977 12:94201271-94201293 CAACATGCCTTTTCTATGTAAGG - Intronic
1100434751 12:94561310-94561332 GAAAATTCATTTTCTCTGTAAGG + Intergenic
1100519520 12:95360038-95360060 CCACGTGTATTTTTTCTGTAAGG - Intergenic
1101894874 12:108748768-108748790 ACACATGTATTTTCCCCATAAGG + Intergenic
1102552178 12:113699506-113699528 ACTCATGGAATATCTCTGTATGG + Intergenic
1103050730 12:117777261-117777283 ACACAGGTATTTTCTCCATAAGG + Intronic
1103068789 12:117923118-117923140 ACACACACATTTTCTCTGTAAGG - Intronic
1103123779 12:118403276-118403298 TCCCATGCATTATCACTGTAAGG + Intronic
1104687194 12:130794382-130794404 ACACCTGAAATTACTCTGTAAGG - Intronic
1105598879 13:21867505-21867527 ACACATGCATTTTATCAGAAAGG - Intergenic
1105708863 13:22986068-22986090 ACACAAGTGTTGTCTCTGTAGGG + Intergenic
1106300335 13:28458567-28458589 ACAAATGCATCTTCTCTCTTTGG - Intronic
1106749528 13:32746549-32746571 GCACACACATTTTCTCTGTAAGG + Intronic
1106773506 13:32985945-32985967 ACACACGTATTTTCTCCATAAGG + Intergenic
1106815877 13:33406629-33406651 AAACTTACCTTTTCTCTGTAAGG + Intergenic
1107094507 13:36520380-36520402 ACACATGCAAATTCTCTACACGG - Intergenic
1107671623 13:42752397-42752419 ACATATGCATATTTTCTGTAAGG + Intergenic
1109751882 13:66704422-66704444 AGACATGAATTGTCTATGTAAGG - Intronic
1109959639 13:69613730-69613752 ACACATGAATTTCATTTGTATGG - Intergenic
1110061956 13:71052700-71052722 ATAAATGCATTTTATCTATAAGG - Intergenic
1110362469 13:74642990-74643012 ACACATGCATATCCTCTCCAAGG + Intergenic
1110443068 13:75547085-75547107 ATATGTGTATTTTCTCTGTAAGG + Intronic
1110490539 13:76099813-76099835 ACACAGGTATTTTCTCAGTAAGG + Intergenic
1112121557 13:96418042-96418064 ACACATGTATTTTCTTCATAAGG + Intronic
1112179563 13:97064627-97064649 ACACATGTATTTTCTCCAGAAGG - Intergenic
1112618283 13:101027701-101027723 CCACATGCCTTTTCCCTCTAAGG - Intergenic
1112714357 13:102166651-102166673 ACCCACGTATTTTCCCTGTAAGG - Intronic
1112742313 13:102488955-102488977 AAACATGCTTTTTCTCTTTTTGG - Intergenic
1113264567 13:108603311-108603333 ACACATGCACTATCTCTATTAGG - Intronic
1113675482 13:112203830-112203852 GCACATGCATGTTGTATGTATGG - Intergenic
1114393642 14:22337158-22337180 TCACATTTATTTTCTCTGTCTGG + Intergenic
1115019834 14:28663294-28663316 ACACACGTATTCTCTCTGTAAGG + Intergenic
1115104401 14:29743329-29743351 TCACATGCCTTTTCACTGGAAGG + Intronic
1115248507 14:31320957-31320979 ACACATGTACTTTCTATATATGG + Intronic
1116827997 14:49690652-49690674 TCACATGTATTTTCTCCATAAGG + Intergenic
1117231789 14:53726694-53726716 AAACATCTATTTTCTCTGTGAGG - Intergenic
1117337050 14:54764945-54764967 ACACATTCATTATTTCTTTATGG - Intronic
1117492515 14:56264329-56264351 TAACATGTAGTTTCTCTGTACGG - Intronic
1118011569 14:61615382-61615404 ATACAAGCAGTTTCTCTGTTAGG + Intronic
1118147539 14:63157049-63157071 ACACATGGGTTGTTTCTGTATGG + Intergenic
1118508073 14:66437732-66437754 ACACACATATTTTCTTTGTAAGG + Intergenic
1119135862 14:72218993-72219015 ACACATGGACTTTCTCTATCAGG + Intronic
1119687511 14:76644371-76644393 ACACCTGCGGTTTCTCTGCACGG - Intergenic
1120629351 14:86871085-86871107 AGACACATATTTTCTCTGTAAGG + Intergenic
1121045478 14:90784674-90784696 CCCCATTCAGTTTCTCTGTAAGG - Intronic
1121143875 14:91566689-91566711 ACACACATATTTTCTCTGTAAGG + Intergenic
1121255870 14:92529818-92529840 ACACACATATTTTCTCTGTAAGG - Intronic
1121360968 14:93259289-93259311 ACTCATGTATTATCTCTGTATGG + Intronic
1121608752 14:95261086-95261108 ACACATGTATTTTCTCCGCAAGG + Intronic
1122676707 14:103421017-103421039 ACACCTGCATTTTCTTTGTAAGG + Intronic
1123757626 15:23409133-23409155 AAACATTCATTTTCACTGAAAGG - Intergenic
1124190235 15:27568581-27568603 ACACCTGCATTGTCTCTGGCTGG + Intergenic
1126385308 15:48088057-48088079 ACACATGCCTTGGCTCTCTAGGG - Intergenic
1126765976 15:52011465-52011487 TAACATGTATTTTCTCTGTAGGG - Intronic
1127145362 15:56017779-56017801 ACCCATATATTTTCTCTGTAAGG + Intergenic
1127337802 15:58007018-58007040 ACACATGTATTTTCTCTGTAAGG - Intronic
1127423346 15:58830619-58830641 GCACATGTATTTTCTCTATAAGG + Intronic
1127706875 15:61556167-61556189 CCACATGCATTTCCTCTGTCTGG - Intergenic
1128273975 15:66336931-66336953 ACAGATACATTTTCTCTTAATGG + Exonic
1129050242 15:72775083-72775105 ACACATGCATTGACTCTAGAAGG + Exonic
1129125179 15:73434114-73434136 ACACATGTATTTTCTCTATAAGG + Intergenic
1130763098 15:86841204-86841226 ACACTTGTATTTTATCTGTTTGG - Intronic
1130877996 15:88031017-88031039 ACACATGTGTTTTTTCTGTGAGG - Intronic
1130969314 15:88719675-88719697 ACACACGTATTTTCTCCATAAGG + Intergenic
1131048411 15:89330870-89330892 ACACATACATTTTCTCATTCTGG - Intronic
1131050577 15:89345121-89345143 ACATACGTATTTTATCTGTAAGG + Intergenic
1131332630 15:91515886-91515908 ACATGTGCATTTTTGCTGTAGGG + Intergenic
1131381959 15:91971593-91971615 ACACACATATTTTCTCTGTAAGG - Intronic
1133543126 16:6775638-6775660 CCAAATTCACTTTCTCTGTAAGG - Intronic
1134454638 16:14385914-14385936 ACATACACATTTTCTCTGTGAGG - Intergenic
1134909096 16:18008115-18008137 ACACCTGCATTTTCTGAGAAAGG + Intergenic
1135282294 16:21163087-21163109 ACACATGTATTTTCTGCATAAGG + Intronic
1135386567 16:22046569-22046591 ACACACATATTTTCTCTGAAAGG + Intronic
1135520595 16:23174357-23174379 ACACATATATTTTTTCAGTAAGG - Intergenic
1136098302 16:27974601-27974623 ACACATGGCATTTCTCTTTAAGG - Intronic
1138737867 16:59272829-59272851 ACACATGTATTTTCTCAGTAAGG - Intergenic
1139306731 16:65992735-65992757 ACAAATGCATTTTGACTGAATGG - Intergenic
1140244991 16:73240131-73240153 ACACATGTGTTTTCTTTGTAAGG + Intergenic
1140300739 16:73755010-73755032 ACACAAGCATCTCCTTTGTAAGG - Intergenic
1140343934 16:74193919-74193941 ACACACGTATTTTCTCTGTAAGG + Intergenic
1141138024 16:81479155-81479177 ACGCATGTGTTTTCTCTGTGGGG - Intronic
1142821323 17:2470178-2470200 ACACACGTGTTTTCTCTGTAAGG + Intronic
1144166705 17:12618626-12618648 ACACATGCATTTTCTCTGTAAGG - Intergenic
1144262424 17:13535272-13535294 ACATATGTATTTTCCCTGCAAGG + Intronic
1144451201 17:15380583-15380605 ACACAAGCATTTTCTCCATAAGG + Intergenic
1145289455 17:21531685-21531707 TAACAAGCGTTTTCTCTGTAAGG - Exonic
1145854608 17:28141939-28141961 ACATATGCATTTGCTTTGGAGGG + Intronic
1146543723 17:33719835-33719857 ACACATTCATTCTCGCTGTGCGG - Intronic
1150707817 17:67503503-67503525 GCCCTTGTATTTTCTCTGTAGGG + Intronic
1150809097 17:68342663-68342685 ACACATACATTTTCTTTATAAGG + Intronic
1153446913 18:5183924-5183946 ACACATGTATTTTCTCCATAAGG + Intronic
1153920141 18:9781811-9781833 ACACATGCAGTTTTCCTGGAAGG + Intronic
1154013860 18:10598836-10598858 ACACACGTATTTTCTCTGTAAGG + Intergenic
1154153154 18:11922839-11922861 ACACACATATTTTCTCTGTAAGG + Intergenic
1155051705 18:22153764-22153786 ACACATATATTTTCTGGGTAAGG - Intergenic
1155155852 18:23156781-23156803 GAACATGTTTTTTCTCTGTAAGG + Intronic
1155685718 18:28547171-28547193 ACACATGTATTTTCTCCATAAGG + Intergenic
1156871093 18:41945926-41945948 ACACAAGTATTTTCTTTGTAAGG + Intergenic
1157572107 18:48719851-48719873 ACACACACATTTTCTCCGGAAGG - Intronic
1157802389 18:50631306-50631328 ACACACACATCTTCTCTGTGAGG - Intronic
1158648996 18:59269996-59270018 AGACTTGCTTGTTCTCTGTATGG + Intronic
1158817214 18:61116250-61116272 ACAGATGCATTTTCCCCTTAGGG - Intergenic
1158879982 18:61768787-61768809 ACACATGTATTTTCTCCATGAGG - Intergenic
1158931416 18:62327465-62327487 AGAAATGCATTTTCTCTCAAAGG + Intronic
1158934634 18:62353334-62353356 ACACACTTATTTTCTCTGTAAGG + Intronic
1158942891 18:62422180-62422202 ACACATGTATTTTCTCCATCAGG + Intergenic
1159367973 18:67494355-67494377 ACACTTGTATTTTCTTTGTAAGG - Intergenic
1159477197 18:68937165-68937187 ACACATGTGTTTTCTCCCTAAGG + Intronic
1159526431 18:69597499-69597521 ACACATGTATTTTCTCCATAAGG + Intronic
1159616196 18:70582889-70582911 ACACATGTATTTTATGTTTATGG + Intergenic
1159859769 18:73633492-73633514 ATATATGTATTTTCTCTGTAAGG + Intergenic
1160367175 18:78336232-78336254 ACACATGGGTTTTCTCTGTGAGG - Intergenic
1161942842 19:7416514-7416536 ACACACGAATTTTCTCCGTGAGG - Intronic
1163352734 19:16788679-16788701 GCAGATGTATTTTTTCTGTAAGG + Intronic
1164849202 19:31466661-31466683 AAACAAGCATTATCTCTGCAAGG - Intergenic
1167141770 19:47656285-47656307 ATACGTGTATTTTCTCTGAAAGG - Intronic
925804615 2:7635973-7635995 ACACATGCCCTTTCTCTTTCAGG - Intergenic
925934643 2:8743751-8743773 ACACATGCCTTTCCTCTTGAGGG - Intronic
926705158 2:15832025-15832047 GCACATGTATTTCCTCTGTAAGG + Intergenic
926758540 2:16255312-16255334 ACACATGCATTTTCTCCATAAGG + Intergenic
926802385 2:16670277-16670299 ACACATGTATTTTCTCTGTAAGG + Intergenic
928036287 2:27826851-27826873 ACACAGACATTTTTTATGTAAGG - Intronic
928400311 2:30973057-30973079 ACCCATTCATTTTCTCTTTGTGG - Intronic
929084285 2:38152943-38152965 ACACATGTATTTTCTCTGTAAGG - Intergenic
930617180 2:53605845-53605867 TCACATCCATATTCTCTGGAAGG - Intronic
930858697 2:56046603-56046625 AGACATTGATTTTCTCTTTAAGG + Intergenic
931306135 2:61030551-61030573 ACACCTGTATTTTCTCTGTAAGG - Intronic
931317939 2:61150092-61150114 AGTCATGGATATTCTCTGTAGGG + Intronic
931598905 2:63982650-63982672 ACACATGTATTTTCTCCATAAGG + Intronic
931615713 2:64154989-64155011 ACACATGTATTTTCTCTATAAGG + Intergenic
931627071 2:64266210-64266232 ACACACGTATTTTCCCTGTGAGG + Intergenic
932496165 2:72146911-72146933 ACACACGCACTCTCTCTCTATGG + Intronic
933091485 2:78124772-78124794 ACGTAGGCATTTTCTCTGTAAGG + Intergenic
933171142 2:79127507-79127529 ACAAATCCAGTTTGTCTGTAAGG + Intergenic
933305139 2:80588195-80588217 ACACATGTGTTTTCTCCATAAGG + Intronic
933596276 2:84286610-84286632 ACATATGTATTTTCTCCATAAGG + Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
935680442 2:105631472-105631494 ACATATGAGTATTCTCTGTAAGG - Intergenic
936598318 2:113870785-113870807 ACACACGTATTTTCTCCATAAGG - Intergenic
936842801 2:116793585-116793607 AGACATTCATGTTCTATGTAAGG + Intergenic
936887021 2:117322913-117322935 CCAGAAGCATTTTCTCTCTATGG - Intergenic
936943381 2:117908640-117908662 ACTCCTGCATTCACTCTGTAAGG + Intergenic
937331828 2:121035771-121035793 ACATATAAATTTTCTCTGTAAGG + Intergenic
937424829 2:121790095-121790117 ACACACATATTTTCTCTATAAGG - Intergenic
938314769 2:130317958-130317980 ACAGTTTCATTTTCTGTGTATGG - Intergenic
938612836 2:132966772-132966794 ACACATGTATTTTATCTGTAGGG + Intronic
939059496 2:137403056-137403078 TCACCTGCATTTTCTTTGTTGGG - Intronic
939439600 2:142229104-142229126 ACACTTGGATTTTCCATGTAAGG - Intergenic
939970837 2:148658233-148658255 ACACATGTATTTTCTCCATGAGG + Intronic
940205869 2:151201112-151201134 ACACAAGCATTTTTGCTGCAAGG - Intergenic
942189298 2:173455156-173455178 ACACGTGCACTGTCTCTCTAAGG - Intergenic
942305464 2:174602934-174602956 TCACATGCTTTTCCTCTGTCTGG - Intronic
942533433 2:176937304-176937326 ACACATGAACTTTCTTTATAAGG - Intergenic
943445582 2:187982986-187983008 ACACACACACTTCCTCTGTAAGG - Intergenic
943700405 2:190983025-190983047 ACACATGTATTTTCTCCATAAGG - Intronic
944214847 2:197244821-197244843 ACACATGCTTTTACTATGTATGG - Intronic
945866990 2:215187203-215187225 GCACATACATTTTCTCTGGAAGG - Intergenic
946932732 2:224687074-224687096 ACACTTGTATTTTCTCTGGCAGG - Intergenic
947064152 2:226200939-226200961 ACAAATGCTTTCTCTCTCTAAGG + Intergenic
947942949 2:234074882-234074904 ACACACACATTTTCTCTGTAAGG + Intronic
948400642 2:237682488-237682510 TCACTTGCATTCTCTGTGTAGGG + Intronic
1169181190 20:3568797-3568819 ACACACGTATTTTCTCAGTAAGG + Intronic
1169401030 20:5280522-5280544 TAACACACATTTTCTCTGTAAGG + Intergenic
1169873978 20:10276060-10276082 ATTCATCCATTTTATCTGTAGGG + Intronic
1170145323 20:13167473-13167495 ACATATGCATTTTTCCTTTACGG + Exonic
1171020181 20:21577683-21577705 GCACATGGATTTCCTCTGTAAGG + Intergenic
1171315685 20:24191909-24191931 ACACAAGTATTTTCTATGTAAGG - Intergenic
1172779544 20:37427754-37427776 ACACATGCTCCTTCTCTGTCTGG + Intergenic
1173460464 20:43239203-43239225 ACACAAGTATTTTCTCTTTATGG - Intergenic
1173762620 20:45577294-45577316 ACACAAGTAATTTCTTTGTAAGG - Intronic
1174332899 20:49834549-49834571 ATACATTCATTTTCTCTGTTGGG + Intronic
1174447397 20:50599486-50599508 TAACACACATTTTCTCTGTAAGG + Intronic
1174473805 20:50781586-50781608 AGACAAGTATTTTCTTTGTAAGG - Intergenic
1177040837 21:16108381-16108403 ACACACATACTTTCTCTGTAAGG - Intergenic
1178159895 21:29899994-29900016 ATAAATACATTTTCTATGTAAGG + Intronic
1178728294 21:35075197-35075219 ACACGGGCATCTTTTCTGTAGGG + Intronic
1179930123 21:44563904-44563926 ACATACATATTTTCTCTGTAAGG + Intronic
1180044112 21:45295002-45295024 ACACTTGCACTTGCTCTGGAGGG - Intergenic
1181263518 22:21615978-21616000 ACACATGTATTTTCTCCAAAAGG - Intronic
1181974074 22:26715971-26715993 ATGCAGCCATTTTCTCTGTAAGG + Intergenic
1182179175 22:28327391-28327413 AAACTAGTATTTTCTCTGTAAGG - Intronic
1183216996 22:36487181-36487203 AAACATACATTTTCTCAGCAAGG + Exonic
1184915821 22:47568303-47568325 ACACGTGTATTTTTTGTGTAAGG - Intergenic
949113364 3:290054-290076 ACACAGTTTTTTTCTCTGTAAGG + Intronic
949157267 3:844212-844234 AAACATGCATTTTGTCTCCATGG + Intergenic
949259975 3:2094674-2094696 ACACATGTATTTTCTCTGTGAGG - Intergenic
949399688 3:3653132-3653154 ACAAATGCATATTCTGTGTGAGG - Intergenic
949609614 3:5691045-5691067 AAACATGAATTTTCTCAGCAAGG + Intergenic
950040947 3:9918662-9918684 TCACATGCATTATCTCTTTGAGG + Intronic
950239354 3:11354128-11354150 ACCCTTGCATTTTATCTGCATGG + Intronic
950519521 3:13488454-13488476 TCACCTGCATTCTCTCTCTATGG + Intronic
950606243 3:14083626-14083648 TCACATGTATTTTCTCCATAAGG + Intergenic
950762729 3:15247855-15247877 ACACATTCATGTCCTTTGTAGGG + Intronic
950768979 3:15295561-15295583 ACGCAAGCATTTTCTCCATAAGG - Intronic
950861729 3:16153433-16153455 ACACATGTATTTTCTGTGTGAGG + Intergenic
951070148 3:18318602-18318624 ACACACATGTTTTCTCTGTAAGG + Intronic
951281027 3:20750200-20750222 TCACATGACTTTTCTCTGTTGGG - Intergenic
952264581 3:31773288-31773310 ACATAAATATTTTCTCTGTAAGG + Intronic
952900104 3:38106418-38106440 ACACATGGAATTTCTTTGTCTGG + Intronic
955059502 3:55483409-55483431 ACACATACATCGGCTCTGTAGGG + Intronic
955829494 3:62986087-62986109 ATGCATGCATTTTCTCCTTAAGG - Intergenic
956186180 3:66564519-66564541 ACACACGTATTTTCTCTGTAAGG + Intergenic
956760647 3:72440719-72440741 ACCCATGCTTTTTCTCTTTGTGG - Intronic
956967244 3:74476060-74476082 ACACCTATATTTTCTCCGTAGGG - Intronic
957117039 3:76039581-76039603 ACATAAACATTTTCTCTGTTGGG + Intronic
957706076 3:83786358-83786380 ATACAAGCATTTTCTCTGGAAGG + Intergenic
957816051 3:85298441-85298463 ATACATGCATTTTCAATGAAGGG - Intronic
958119993 3:89273827-89273849 TAACATGTATTTTCTCTGTAAGG + Intronic
958603506 3:96329408-96329430 ATACATGCATTTTCTCCATCAGG + Intergenic
960366186 3:116775666-116775688 ACACATGTACTTTCTCCATAAGG - Intronic
961124799 3:124407477-124407499 ACACAGGCAGGGTCTCTGTAAGG - Intronic
962360238 3:134735371-134735393 ACACATGTATTTTCTCTGTAAGG + Intronic
963336208 3:143976082-143976104 ACACATACCTTATCTATGTAAGG + Intronic
963417101 3:145010708-145010730 CCACCTGTATTTTCTCTCTAAGG - Intergenic
963629683 3:147717371-147717393 ACACATGTATTTTGACCGTAAGG - Intergenic
963655529 3:148044357-148044379 ACACATGTTTTTTCTTTGTCTGG + Intergenic
963834458 3:150042650-150042672 AAACATGTATTTTTGCTGTAAGG + Intronic
964240849 3:154592725-154592747 ACACATGCATTTTCTCCGTAAGG - Intergenic
964364592 3:155935799-155935821 ACACACAGATTTTCTCTGTAAGG - Intronic
966042051 3:175503390-175503412 ACATATGCATTGTGTCTTTATGG + Intronic
966481713 3:180416574-180416596 ACACATCTATTTTCTCCATAAGG - Intergenic
967023456 3:185543303-185543325 ACACATGTATTTTCTCTCTAAGG - Intronic
967972307 3:195008211-195008233 ACACCAGCACTTTCTCTGCAAGG - Intergenic
968009945 3:195267825-195267847 TCACATGCCTTTCCTCTGTCTGG - Intronic
968790023 4:2653306-2653328 ACACATACATGTTCTCTCTAGGG + Intronic
969576174 4:8037394-8037416 AGACAGGCATGTTCTCTGTGTGG - Intronic
970366183 4:15360505-15360527 ACACATGTATTTTCTTCATAAGG + Intronic
970537789 4:17047131-17047153 ACACACGCATTTTCTCCGTAAGG - Intergenic
970921614 4:21401326-21401348 AAACATGGACTTTCTCTTTAAGG + Intronic
971074961 4:23137456-23137478 GAACATGTATTTTCTCTGTAAGG - Intergenic
971272372 4:25162046-25162068 TTACATGCATTTTATCTATATGG + Intronic
971661316 4:29419967-29419989 ATACACATATTTTCTCTGTAAGG + Intergenic
972276393 4:37561928-37561950 ACACACACATTTTCTCTGTAAGG + Intronic
973301409 4:48589135-48589157 ACATCTACATATTCTCTGTAAGG - Intronic
974012816 4:56623149-56623171 ACATAGCCATTTTCTCTCTAGGG + Intergenic
978389478 4:108209919-108209941 ACACATTTTTTTTCTCTGTAAGG - Intergenic
978784423 4:112593688-112593710 ACACATGCTGTTTCTTTGCATGG + Intronic
979125866 4:116970619-116970641 ATACATGGATTTTGACTGTATGG - Intergenic
979490494 4:121321240-121321262 ACACATGCATTTCTTCTTGAAGG - Intergenic
980823148 4:138042033-138042055 ATATATGTATTTTTTCTGTAAGG + Intergenic
981142420 4:141283995-141284017 ACACATTTATTTTCTCCATAAGG - Intergenic
981756952 4:148150423-148150445 ACACACCTATTTTCTCTGTGAGG + Intronic
982495974 4:156092434-156092456 CCATATCCTTTTTCTCTGTATGG - Intergenic
982750062 4:159150428-159150450 ACACACATATTTTCTCTGTAAGG + Intronic
983309926 4:166046647-166046669 ACACACGTGTTTTCTCAGTAAGG - Intronic
983312865 4:166087663-166087685 ATATATGCAGTTACTCTGTAAGG + Intronic
983982832 4:174019980-174020002 AGTCATGCATTTTCACTGAAGGG - Intergenic
984207837 4:176808158-176808180 AAACATGAATTTTCTCAGCAAGG + Intergenic
984312585 4:178081909-178081931 ATACCTGTATTTTCTCTGTAAGG + Intergenic
984937146 4:184899343-184899365 ACACCTGCTTTTTATCTGTCTGG - Intergenic
985272506 4:188207496-188207518 ACACATGCAAATCCTCTCTAAGG - Intergenic
986599111 5:9453507-9453529 ACACATGCATTTTCTTCATAGGG - Intronic
986840710 5:11694028-11694050 ACACATATATTTTCTCCGTAGGG + Intronic
987004728 5:13698607-13698629 ACACATGTGTTTTCTCCATAAGG + Intronic
989068399 5:37485566-37485588 ATGCATCTATTTTCTCTGTAAGG - Intronic
992305383 5:75431877-75431899 ACACATGCATGTGGTCTTTATGG + Intronic
993200416 5:84808885-84808907 ACAAAGGAATTTTCTCTATAAGG - Intergenic
993358988 5:86949666-86949688 AAACCTGCATTCTCTCTGGATGG + Intergenic
993373661 5:87122353-87122375 GCACTTGCTGTTTCTCTGTATGG + Intergenic
994421447 5:99530008-99530030 ATGCATGTATTTTCTCTGTAAGG - Intergenic
994485598 5:100384303-100384325 ATGCATGTATTTTCTCTGTAAGG + Intergenic
996177020 5:120371103-120371125 TCTAATGCATGTTCTCTGTAGGG - Intergenic
996281666 5:121736993-121737015 ACACATGCATTTTCTCCATAAGG + Intergenic
996354929 5:122585155-122585177 ACACATGCGTTTGCTCTCTGGGG - Intergenic
996444454 5:123529106-123529128 ACACATGAATTTTTTCCATAAGG - Intronic
996665343 5:126052509-126052531 ACACACATATTTTCTCTGTAAGG - Intergenic
996700907 5:126449085-126449107 AAATATGCATTTTCTCTATCTGG - Intronic
996756379 5:126939926-126939948 ACACACGTATTTTCTCTACAAGG + Intronic
996768289 5:127057916-127057938 ACACATGTATTTTCTCCATAAGG - Intronic
997168131 5:131684020-131684042 ACACATGTATTTTTTCTGTAAGG + Intronic
997385683 5:133470296-133470318 TCACATGGATTATCTCTGTTTGG - Intronic
997973463 5:138423755-138423777 ACACATGCATGTAGACTGTAGGG - Intronic
998371230 5:141662833-141662855 ACACATGTATTTTCTCTGTAAGG - Intronic
998480088 5:142455662-142455684 ACACATGTATTTTCTTTGCAAGG - Intergenic
998563713 5:143196599-143196621 ACACACACATTTTCTCTATAAGG + Intronic
999725304 5:154431926-154431948 ATACATATATTTTCCCTGTAAGG + Intergenic
1000260419 5:159582956-159582978 ACGCATATATTTTGTCTGTAAGG + Intergenic
1000639827 5:163688297-163688319 ACACATGCATTTACTGGGCAGGG - Intergenic
1000977426 5:167780575-167780597 ACACATGTATTTCCTCTGTAAGG - Intronic
1001778832 5:174350266-174350288 ACTCATTCATTTATTCTGTAAGG + Intergenic
1001812406 5:174638998-174639020 CCACTTGCATTTTCTCTGGGAGG - Intergenic
1002454439 5:179338260-179338282 ACATATGCAGGTTCTCTGTGTGG - Intronic
1002567849 5:180122007-180122029 TCACACACATTTTCTCTGTGAGG - Intronic
1004064561 6:12230461-12230483 ACGCATGTATTTTCTCTGTAAGG + Intergenic
1004341204 6:14808984-14809006 ACACACGCGTCTTCTCTGTAGGG + Intergenic
1004749821 6:18550624-18550646 ACACAGGCGTTTTCTCTGTAGGG + Intergenic
1005058725 6:21756462-21756484 ACACGTGCCTTTTCTCTGCAAGG + Intergenic
1005548358 6:26891786-26891808 ATGCATGTATTTTCTCTGTAAGG + Intergenic
1005677820 6:28173862-28173884 ACACACCTATTTTCTCTGTAAGG + Intergenic
1007461624 6:42023333-42023355 TCTAATGTATTTTCTCTGTAAGG - Intronic
1007492193 6:42231945-42231967 TCACATGGAGTTTCTATGTAAGG + Intronic
1007499246 6:42283015-42283037 ATTCACCCATTTTCTCTGTAAGG + Intronic
1008529267 6:52440336-52440358 AGACATGCATTTTCTCCATGAGG + Intronic
1008955285 6:57208981-57209003 ACATATTTATTTTTTCTGTAAGG + Intronic
1008985792 6:57541572-57541594 ATACATGGATTTTAACTGTATGG + Intronic
1009019115 6:57932896-57932918 ATGCTTGTATTTTCTCTGTAAGG + Intergenic
1009059643 6:58383099-58383121 ATGCATGTATTTTTTCTGTAAGG - Intergenic
1009231265 6:61064303-61064325 ATGCATGTATTTTTTCTGTAAGG + Intergenic
1009696458 6:67110919-67110941 ACAGAGGCATTATCTCTGAATGG + Intergenic
1009827011 6:68879611-68879633 ACACATGCTTTTTTTCTATCAGG - Intronic
1010564523 6:77393290-77393312 ACATATGTATTTCCTCTATAAGG + Intergenic
1010620267 6:78064878-78064900 ACACATGTATTTTTTCCTTATGG + Intergenic
1012856240 6:104505401-104505423 ACAGATGCATTGTCAGTGTAGGG + Intergenic
1013465594 6:110414667-110414689 ACAACTGCATTTTCTCTCTCTGG - Intronic
1014254769 6:119149963-119149985 ACACATGCATTGTCTCATTCAGG - Intergenic
1014741313 6:125150692-125150714 ACATATATATTTTCTCTCTAAGG - Intronic
1015147127 6:129999830-129999852 TGACATGCATAATCTCTGTATGG - Intergenic
1015153398 6:130063701-130063723 GCACAAGTATCTTCTCTGTAAGG + Intronic
1015302719 6:131672400-131672422 ACACACATATTTCCTCTGTAAGG - Intronic
1015414719 6:132935191-132935213 ACACATGCAGTTGCTTTGTGTGG - Intergenic
1015551492 6:134416802-134416824 ACCCATTCATTTTCTCTGCAGGG + Intergenic
1015595482 6:134862236-134862258 ACACATGCAATTTCTCTGTAAGG + Intergenic
1015934811 6:138398154-138398176 TCACATATATCTTCTCTGTAAGG - Intergenic
1016158730 6:140848640-140848662 ACACATGTATTTTCTCCATAAGG + Intergenic
1016701194 6:147056084-147056106 ACACATTCATTTTCCCTTTGAGG + Intergenic
1016931940 6:149420156-149420178 ACACATGTATTTTCTCGCTAAGG - Intergenic
1017347414 6:153400325-153400347 ACACATGCATTTTCTCCCTAAGG - Intergenic
1017350300 6:153433075-153433097 TCACATGGAATTTTTCTGTAGGG - Intergenic
1017952514 6:159148135-159148157 ACACACGTATTTTCTCCATAAGG + Intergenic
1018139305 6:160812091-160812113 ACATATGAATTTTCTCCCTAAGG + Intergenic
1018226373 6:161633139-161633161 ACACATGCATTTTTTCTGAAAGG - Intronic
1018232808 6:161691585-161691607 ACACATGTATTTTCTCCACAAGG + Intronic
1019538779 7:1542114-1542136 ACGCAGGCCTTTGCTCTGTAGGG - Exonic
1021469583 7:20986084-20986106 ACACACATGTTTTCTCTGTAAGG + Intergenic
1022354319 7:29598021-29598043 TAACATGGATTTTCTCTGTAGGG + Intergenic
1022384371 7:29888046-29888068 ACACCATCATCTTCTCTGTAAGG + Exonic
1023192693 7:37599732-37599754 GAACATGCTTTTTCTCTGTCAGG + Intergenic
1024549002 7:50544978-50545000 ACACATATATTTTCTCCATAAGG + Intronic
1024549096 7:50545867-50545889 ACACATGTATTTTCTCCATAAGG + Intronic
1024753993 7:52506427-52506449 TCACATTTATTTTCTCTCTACGG + Intergenic
1024793428 7:52993531-52993553 ACACAGGAATTTTCTCCATAAGG - Intergenic
1026219908 7:68386237-68386259 ACACATGTATTTTCTCCATAAGG - Intergenic
1027713960 7:81645471-81645493 ACACATCTATTTTCTGTGTATGG + Intergenic
1027936755 7:84615353-84615375 ACACATGCACTTAATCTTTAAGG + Intergenic
1028042671 7:86075126-86075148 ACAAATGCATATCCTCTGTTGGG - Intergenic
1028117336 7:87014114-87014136 TAACATGTATTTTCTCTGTAAGG - Intronic
1028624802 7:92865394-92865416 AAGAATGCATCTTCTCTGTAAGG + Intergenic
1028897534 7:96059210-96059232 ACACATGTATTTTTCCAGTAGGG + Intronic
1029166006 7:98591437-98591459 GCTCATGCATTTTATCTTTAAGG + Intergenic
1029233594 7:99092679-99092701 ATCCATGCATTTTCTTTGCAAGG - Intronic
1029993971 7:104988484-104988506 ACACAAGCTTTTTCTATATAGGG + Intergenic
1031141205 7:117945584-117945606 AGACAGGCATCTTCTCTGTGAGG - Intergenic
1031547423 7:123067975-123067997 ACACATGCATTGGCTGGGTAGGG + Intergenic
1031957250 7:127955113-127955135 GCACATGCAGCTTCTCTGTGTGG + Intronic
1031971926 7:128071146-128071168 ACACATGTATCTTCTCCATAAGG - Intronic
1032373178 7:131381130-131381152 ACACATGTATTTTCTCCATAAGG + Intronic
1032557288 7:132849845-132849867 ACACAGGCTTTTGCTCTTTAAGG - Intronic
1032790560 7:135239417-135239439 GGTCATGCATTGTCTCTGTATGG + Intronic
1033034974 7:137866511-137866533 ACAGATGTATTTTCTCCATAAGG + Intergenic
1033289905 7:140074896-140074918 ACACGTGTGTTTTCTCTGTGAGG + Intergenic
1033496789 7:141906874-141906896 ACACATGCATTTTCTCTGTAAGG + Intergenic
1034178376 7:149118368-149118390 ACACATACATTTTTACTTTACGG + Intronic
1034327702 7:150251743-150251765 ACACAGTAATTTTCTGTGTATGG - Intronic
1034765509 7:153717686-153717708 ACACAGTAATTTTCTGTGTATGG + Intergenic
1034857431 7:154565044-154565066 AAAGATGCATTTTCTCCATAAGG - Intronic
1036409006 8:8480960-8480982 ACACACATATTTTCTCTGTAAGG + Intergenic
1037165011 8:15816742-15816764 AAACATGCCGTTTCTCTGTGAGG - Intergenic
1037652760 8:20854046-20854068 AAACATGCATTTTCTTCTTATGG + Intergenic
1038278854 8:26144447-26144469 ACACATGTATTTTCTCAATAAGG + Intergenic
1039620804 8:38996032-38996054 ACACAAGAGTTTTCTCTGCACGG + Intronic
1039690733 8:39862044-39862066 ACACATTCATCTTCTCAGAAAGG - Intergenic
1039715886 8:40108697-40108719 ACTCATTTATTTTCTCAGTAGGG + Intergenic
1039859647 8:41446087-41446109 ATACATGTATTTTCTCCATAAGG - Intergenic
1041115849 8:54535844-54535866 ACATATGTATTTTCTCTACAAGG + Intergenic
1041479389 8:58300844-58300866 ACACATGTATTTTCTCTATGGGG + Intergenic
1041488349 8:58404091-58404113 GCACATGCATTTTCTCCATAAGG - Intergenic
1041782688 8:61595348-61595370 AAACATGTATTTTCTCTATTGGG - Intronic
1042209493 8:66365508-66365530 ACACATGTATTTTCCCCGTAGGG - Intergenic
1043198796 8:77336163-77336185 ACACATGCACTTTCTTTCTTGGG - Intergenic
1043611577 8:82069600-82069622 ACACACAAATTTTCTCTGTAAGG + Intergenic
1043651644 8:82601460-82601482 ACACATGCACATTCTCTATTGGG - Intergenic
1043830993 8:84989152-84989174 ACACACACATTTTCTCTATAAGG + Intergenic
1043975209 8:86577732-86577754 ACACACATATTTTCTCTGGAAGG + Intronic
1044143076 8:88678436-88678458 ACACATGTATTTTCTCCATATGG - Intergenic
1044471209 8:92570790-92570812 ACACACACATTTTCTCCGTGAGG + Intergenic
1044799504 8:95939291-95939313 ATACATGTATTTTCTGTGTAAGG - Intergenic
1044876274 8:96670069-96670091 ACACACATGTTTTCTCTGTAAGG + Intronic
1044879016 8:96702941-96702963 ACACACACATTTTTTCTATAAGG - Intronic
1045590803 8:103594337-103594359 ACACATGTATTTTCTCCATAAGG - Intronic
1045945055 8:107786200-107786222 ACACATGTATTTTCTCCATAAGG + Intergenic
1046011633 8:108555719-108555741 TCACATGAAATTGCTCTGTAAGG - Intergenic
1046428009 8:114081172-114081194 ACACATGTATTTTCTCTATAAGG + Intergenic
1047242372 8:123102923-123102945 ACACATGTATTTTCTCTGTAAGG - Intronic
1047647883 8:126887840-126887862 AAATATGCATGTTCTCTGTGAGG - Intergenic
1048588640 8:135800294-135800316 ACACATTCATTTTCTAGGCAAGG - Intergenic
1049121019 8:140737801-140737823 AAACATGAAATTTCTCTGAAAGG + Intronic
1049753662 8:144297882-144297904 ACACAGACACTTTCTATGTAAGG + Intronic
1050596384 9:7208408-7208430 TAACATGCATTTCTTCTGTAAGG - Intergenic
1051026512 9:12619200-12619222 CAACATGCATTTTCTCCATAAGG + Intergenic
1051464532 9:17362240-17362262 ACACCTGCTTTTTCTTTGTGGGG + Intronic
1051570239 9:18548434-18548456 ACACACACATTTTCTCCATAAGG - Intronic
1052065241 9:24010342-24010364 ACACATACAGTTTCACTCTAAGG + Intergenic
1052252785 9:26419326-26419348 ACACATTCATATTCTCATTATGG - Intergenic
1052384816 9:27809970-27809992 ACACATGCATATTCTCAATCTGG + Intergenic
1052620625 9:30904456-30904478 ACACACGTATTTTTTCTGTAAGG - Intergenic
1053288994 9:36867822-36867844 ACAAATGAATTTTCTTTATAAGG - Intronic
1054766035 9:69043338-69043360 ACACATGCATTTTCTCTGTAAGG - Intronic
1054848799 9:69824650-69824672 ATGCATGCATTTCCTCTGTAAGG - Intronic
1054852172 9:69858524-69858546 ACACATGTGTTTTCTCTGAAAGG - Intronic
1054941956 9:70753270-70753292 ACAGATACATTTTCTCAGTTTGG - Intronic
1055659527 9:78489057-78489079 ACATATGCATTTTCTCCATAAGG + Intergenic
1055848665 9:80598224-80598246 GCACATGCACATTCTCTGCATGG + Intergenic
1055983198 9:82026950-82026972 ACACATGTATTTTCTCCAAAAGG - Intergenic
1056081698 9:83101930-83101952 ACACATATATTTTCTCTGTAAGG + Intergenic
1056621116 9:88215725-88215747 ACACATGAATTTTCTCCATAAGG + Intergenic
1058649603 9:107162708-107162730 ATACATATGTTTTCTCTGTAAGG - Intergenic
1058775104 9:108275266-108275288 ACACAAGTATTTTCTCCGTAAGG - Intergenic
1059887800 9:118766428-118766450 ACATATGTTTTTTCCCTGTAAGG - Intergenic
1061410621 9:130419286-130419308 ACAAATGCATGTCCTCTGTCTGG + Intronic
1185827188 X:3263098-3263120 ACACAGAGATTTTCTCTGTGAGG + Intergenic
1186265247 X:7825548-7825570 AGACATGTATTTTCTCTGTAAGG - Intergenic
1186300135 X:8191492-8191514 ACACATGCATTCTCTTTCAAGGG - Intergenic
1186363179 X:8863852-8863874 ACATATCCATTTTCTCTGAAAGG + Intergenic
1187673632 X:21693368-21693390 ATAAATTCATTTTCTCTCTAAGG - Intergenic
1188015679 X:25105269-25105291 ACACATACATTTTCTGTTTTAGG + Intergenic
1188752140 X:33917902-33917924 ACACGTGCCTTTTCTGTGTAAGG - Intergenic
1189140251 X:38597457-38597479 ATACACAAATTTTCTCTGTAAGG - Intronic
1189209165 X:39268609-39268631 AAACATGCATATTCTCCATAGGG + Intergenic
1189365744 X:40387188-40387210 TATCATGTATTTTCTCTGTAAGG + Intergenic
1189526951 X:41832825-41832847 ATACATTTATTTTCTCTGTAAGG + Intronic
1190763403 X:53455470-53455492 ACAGATACATTTTCTCTTAATGG + Intergenic
1191175470 X:57496094-57496116 AAACATCTATTTTCTCTGTATGG - Intergenic
1192971170 X:76232631-76232653 ACACATTCTTCTTCTCAGTAGGG + Intergenic
1193305545 X:79946581-79946603 ACACTTGTATTTTCTTTTTAAGG - Intergenic
1195264865 X:103170425-103170447 ACACAATCGTTTTCTGTGTAGGG - Intergenic
1195285562 X:103379208-103379230 TCAGATGCATTTTCTCAGTTAGG - Intergenic
1195293468 X:103451735-103451757 ACACATGCTTTCTTTCTCTAGGG + Intergenic
1195571009 X:106398579-106398601 GCACATGTATTTTCTCCATAAGG - Intergenic
1195717723 X:107833498-107833520 ACTCATGGATTTTCTATGAAGGG + Intronic
1197083181 X:122442292-122442314 ACACATTCATTTTGTGTGTGAGG + Intergenic
1197396676 X:125936196-125936218 ACACATGCATGTCCTTTGTAGGG - Intergenic
1198257475 X:134937020-134937042 TAACGTGCATTTTTTCTGTAAGG - Intergenic
1199221032 X:145315911-145315933 ACACATGTATTTTCTGACTATGG - Intergenic
1199331259 X:146562492-146562514 ATACATGCATTATCTGTGTGAGG + Intergenic
1201251695 Y:12065038-12065060 ACACAGAGATTTTCTCTGTGAGG - Intergenic
1201722310 Y:17113019-17113041 ACACCTTTATTATCTCTGTATGG - Intergenic