ID: 1033501048

View in Genome Browser
Species Human (GRCh38)
Location 7:141950091-141950113
Sequence GGTCATAGTGGAACTCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033501048_1033501052 18 Left 1033501048 7:141950091-141950113 CCAGTCTGAGTTCCACTATGACC 0: 1
1: 0
2: 0
3: 3
4: 153
Right 1033501052 7:141950132-141950154 TCCCACTCGATGAATTAAATGGG No data
1033501048_1033501051 17 Left 1033501048 7:141950091-141950113 CCAGTCTGAGTTCCACTATGACC 0: 1
1: 0
2: 0
3: 3
4: 153
Right 1033501051 7:141950131-141950153 CTCCCACTCGATGAATTAAATGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033501048 Original CRISPR GGTCATAGTGGAACTCAGAC TGG (reversed) Intronic
900174807 1:1286954-1286976 GGTCAGAGTGGGGTTCAGACTGG + Exonic
902079793 1:13813198-13813220 GATCAACCTGGAACTCAGACAGG + Intronic
903780302 1:25816303-25816325 CATCAGAGTGGAAATCAGACGGG + Exonic
904544447 1:31257487-31257509 AGTCATAGTGGAAGGCAGAGGGG - Intergenic
905080730 1:35317929-35317951 TGTCATAGTGGAAGTAATACTGG + Intronic
906053997 1:42900108-42900130 GGGCATAGTGGGAGTGAGACTGG - Intergenic
913383387 1:118233443-118233465 GGTCATGGTGGGAGTGAGACTGG + Intergenic
915726216 1:158019546-158019568 GGTCAGTGTGGAGCTCAGCCTGG - Intronic
921574063 1:216813688-216813710 TGTCATAGTGAAGCTCAGACAGG + Intronic
922822781 1:228495312-228495334 GGTCAGAGAGGAACCCAGTCAGG + Exonic
923458716 1:234188360-234188382 GGGCATGGTGGAAATGAGACTGG + Intronic
923509864 1:234641320-234641342 GGGCATAGAGAAACTCACACTGG + Intergenic
1063168392 10:3484401-3484423 AGTGACAGTGGAGCTCAGACTGG - Intergenic
1064987988 10:21230245-21230267 GGTCATAGTGAAGATCAGAAGGG - Intergenic
1069129603 10:64682293-64682315 GGTCATGGTGGGAGTGAGACCGG - Intergenic
1069422504 10:68260128-68260150 GATCATCGAGGAACTCACACAGG + Intergenic
1077697811 11:4410952-4410974 GGCCATAGAGGAATCCAGACAGG + Intergenic
1080145977 11:28984341-28984363 GGTCATAGTGTGACTGAGAGTGG + Intergenic
1087094186 11:94304766-94304788 GGACCTAGTAGAAATCAGACTGG + Intergenic
1089836922 11:121378977-121378999 GAGCATGGTGGAAGTCAGACTGG + Intergenic
1091357658 11:134950099-134950121 GGTCATATTAGAAAGCAGACGGG + Intergenic
1094336788 12:29366496-29366518 GGTCATAGTAGAATACAAACAGG + Intronic
1095970945 12:47901750-47901772 GTTCATAGTGGAGCCAAGACTGG - Intronic
1097447078 12:59684657-59684679 GGGCAGAGTGGAACCCAGTCAGG + Intronic
1099477195 12:83121983-83122005 GGGCATGGTGGGAGTCAGACCGG - Intronic
1100694765 12:97080499-97080521 GCTAGTATTGGAACTCAGACAGG - Intergenic
1101635302 12:106535600-106535622 GGGCATGGTGGAAGTGAGACCGG - Intronic
1103607748 12:122099543-122099565 GGTCATTGGGGAAATCAGCCCGG - Intronic
1104349895 12:128035946-128035968 GGCCAGAAGGGAACTCAGACAGG + Intergenic
1105046606 12:133008909-133008931 GGTCATAGTGGAAGGCAAAGGGG + Intronic
1106508364 13:30391551-30391573 GGTCAGAGTGAATCTGAGACAGG - Intergenic
1107210436 13:37847447-37847469 GGTCATAGTGTAAATCAAAAAGG + Intronic
1113534988 13:111058918-111058940 GGGCATGGTGGAAGTGAGACTGG - Intergenic
1114174083 14:20303533-20303555 GGTCATAGTGGGATGGAGACAGG - Intronic
1117112734 14:52475480-52475502 GGGCACAGTGGAAGTGAGACTGG + Intronic
1117240662 14:53829321-53829343 GGTCACTGTGGAAATAAGACTGG + Intergenic
1118885581 14:69863216-69863238 GGGCAAAGTGGCACTCAGAAAGG - Intronic
1123007040 14:105328868-105328890 GGTCACAGTGGCACTGAGAGAGG - Intronic
1124584562 15:30992531-30992553 GGGCAGAGTGGAATTCAAACAGG - Intergenic
1124662380 15:31560818-31560840 GGTCAGTGTGGACCTCAGAGGGG - Intronic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1127017739 15:54708069-54708091 GGCCGTTGTGGACCTCAGACGGG + Intergenic
1128075083 15:64820909-64820931 GGCCACAGTGGAACACAGAGAGG - Intronic
1132114987 15:99129498-99129520 GGGCACCGTGGATCTCAGACGGG + Exonic
1132816174 16:1827682-1827704 GGTCAACGGCGAACTCAGACAGG + Exonic
1136555090 16:31002912-31002934 GGTCCCAGCGGAACGCAGACAGG + Intronic
1138656637 16:58495417-58495439 GGTCACTGTGGGACTCAGAGGGG - Intronic
1138708376 16:58940979-58941001 CATCATGGAGGAACTCAGACAGG + Intergenic
1138918821 16:61501859-61501881 GGTCTTATTTGAACTCAGCCTGG + Intergenic
1139632305 16:68237913-68237935 TGTAAGAGTGGAACCCAGACAGG - Intronic
1141574173 16:84953580-84953602 GACCACAGTGGAAATCAGACAGG + Intergenic
1142349255 16:89572292-89572314 GGTCAGCGAGGAACTGAGACTGG + Intergenic
1145076401 17:19858457-19858479 TGTCATTGTGGAACTCTTACAGG - Intronic
1148842071 17:50505468-50505490 GGTGATACTGGGACACAGACAGG + Intergenic
1148963408 17:51412858-51412880 GGTGCTAGTGGGACTCAGGCGGG + Intergenic
1150528624 17:65953611-65953633 GGACACAGTGGGAGTCAGACAGG + Intronic
1151484095 17:74387719-74387741 GGTCATAGAGGAACTGAGGCAGG - Intergenic
1154497251 18:14971054-14971076 GGTCATATTAGAAAGCAGACAGG - Intergenic
1154512850 18:15127069-15127091 GGTCAAAGTGTACCTCAGAAAGG - Intergenic
1158595765 18:58814535-58814557 GGTCATAGTGGAAGGCAAAGGGG - Intergenic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1166017383 19:39992933-39992955 AGTCATAGTGGAAGGCAGAGGGG - Intronic
1166899592 19:46049425-46049447 GGGCATAGTGGGAGTGAGACTGG + Intronic
1167911333 19:52704533-52704555 GGTCATCGGTGAACTCATACTGG - Exonic
1168317089 19:55489128-55489150 GGTCACAGTGGAATTCGGATGGG - Intronic
925641457 2:5989504-5989526 GGGCAGAGTGGAAGACAGACTGG - Intergenic
928772565 2:34719802-34719824 GGGCATGGTGGAAGTGAGACCGG - Intergenic
932426476 2:71639437-71639459 GTTCATAGTGGCACTCTGAATGG - Intronic
934932412 2:98437269-98437291 GGTCAAAGAAGAACTCAGAAGGG - Intergenic
935645778 2:105333022-105333044 GGTGATAGTGGAGCTCAGTTGGG + Intergenic
938513102 2:131971707-131971729 GGTCAAAGTGTACCTCAGAAAGG - Intergenic
939411712 2:141835344-141835366 GGTGATAGTGGAACTGATTCGGG - Intronic
940531454 2:154882914-154882936 GGTCTTAGTGAAACTAACACAGG - Intergenic
941018952 2:160387968-160387990 TGTCCTAGAGGAACTCAGAATGG + Intronic
942332976 2:174848246-174848268 GGTCATAGTGGAAGCCAGTTGGG + Intronic
945809101 2:214526558-214526580 AGTCAAAGTGGAATTCAGCCAGG - Intronic
948067597 2:235092701-235092723 GGTCACTCTGGAACTGAGACCGG - Intergenic
1171378666 20:24714976-24714998 GGGCACAGTGGAAGTGAGACGGG - Intergenic
1171398418 20:24855802-24855824 GGTCACAGTGAAACTGACACAGG - Intergenic
1174674434 20:52339994-52340016 GGTCATTGTAAGACTCAGACGGG + Intergenic
1180115982 21:45705343-45705365 GGTCACAGTAGGACCCAGACTGG + Intronic
1184162108 22:42702956-42702978 GGCCACAGTGGCACTCAGGCCGG + Intronic
950737336 3:15020515-15020537 GGAAATACTGAAACTCAGACAGG - Intronic
951183762 3:19688615-19688637 GGTCATGGTGGGAGTGAGACCGG + Intergenic
951261563 3:20516000-20516022 GGTCATAGTGCATGTCAGGCAGG - Intergenic
952183261 3:30941766-30941788 GGGCATAGTGGGAATAAGACTGG - Intergenic
959757375 3:109914996-109915018 GGACATGGTGGAAGTGAGACCGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961242542 3:125424628-125424650 GGCCATAGTGGAACTATCACAGG + Intergenic
966239786 3:177743621-177743643 GGCCATAGAGGTACTCAGAATGG - Intergenic
967399915 3:189049306-189049328 GGGCATAGTGGGAGTGAGACTGG + Intronic
969318475 4:6396030-6396052 GGTCACCGGGGAACTCACACAGG + Intronic
969901519 4:10354774-10354796 GGGCATAGTGGGAATGAGACTGG - Intergenic
969981224 4:11157385-11157407 GCTCATAGAGGAGCTCTGACTGG + Intergenic
969998626 4:11341251-11341273 GGTCACAGTGGAAGTCAGAGAGG + Intergenic
972616157 4:40700338-40700360 GTTCTTATTGGAACACAGACAGG - Intergenic
976562821 4:86521629-86521651 GGGCATAGTGGGAGTGAGACTGG - Intronic
976663971 4:87570657-87570679 GGACATAGGGGAAGTCAGAGTGG + Intergenic
978761809 4:112361367-112361389 GGGCACAGTGGAAGTGAGACTGG + Intronic
980195102 4:129578290-129578312 GGGCAGAGTGGAAGTTAGACTGG - Intergenic
981011401 4:139928828-139928850 TGACACAGTGGAACTCAGAATGG + Intronic
981864577 4:149400471-149400493 GGAAATAGTGGAACCCAGAAAGG - Intergenic
982398544 4:154940311-154940333 GGTCACAGTGGAATACAGCCTGG - Intergenic
984339383 4:178435773-178435795 GATCATACTAGAACTCAGATAGG + Intergenic
985326516 4:188776584-188776606 GGACATGGTGGAAGTGAGACTGG - Intergenic
987640102 5:20601622-20601644 GGGCATGGTGGAAGTGAGACTGG + Intergenic
989139404 5:38188527-38188549 GGTCAGAGTAGAACACAGGCTGG - Intergenic
992996868 5:82343067-82343089 CCTCACAGTGGAACTCAGAGTGG - Intronic
996372820 5:122771364-122771386 GGCCATAGTAGAACAAAGACTGG - Intergenic
998181814 5:139951397-139951419 GGACATAGTGGATCACAGCCAGG + Intronic
999644326 5:153702990-153703012 GGGCACAGCGGATCTCAGACCGG - Intronic
1000369793 5:160523930-160523952 GGGCATAGGGGAAGGCAGACAGG - Intergenic
1001166593 5:169374382-169374404 GGGCATAGTGGGAGTGAGACCGG + Intergenic
1002298783 5:178246188-178246210 GGTCATGGTGGCGCTCAGCCCGG - Intronic
1005937530 6:30535097-30535119 GGCCATAGAGGAACTCATGCAGG + Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1010198705 6:73264191-73264213 GGGCAGAGTTGACCTCAGACAGG - Intronic
1010478112 6:76314626-76314648 GGTAATAGTCCAAGTCAGACTGG - Intergenic
1010825103 6:80463823-80463845 GGGAATAATGAAACTCAGACAGG + Intergenic
1011222169 6:85066133-85066155 GGTCACTGTGGTAATCAGACTGG + Intergenic
1012588516 6:100950867-100950889 GGTCATAGTGTAATTGTGACTGG - Intergenic
1015025963 6:128532743-128532765 GGTCATCTTGGTACACAGACTGG - Intergenic
1016727503 6:147392096-147392118 GTTCAGAGTCGAACTCAGCCCGG - Intergenic
1018278105 6:162154221-162154243 TGTCAGAGGGGAAATCAGACAGG - Intronic
1020455710 7:8371895-8371917 GGGCATAGTGAAAGTGAGACTGG - Intergenic
1024455745 7:49604881-49604903 GGTCACAGTGGGAATGAGACCGG + Intergenic
1026088898 7:67283927-67283949 GGTCATAGTGTATTTCAGCCGGG + Intergenic
1026725356 7:72866420-72866442 GGTCATAGTGTATTTCAGCCGGG - Intergenic
1032448941 7:132010071-132010093 GGTCACAGTGGGAGTGAGACTGG - Intergenic
1033501048 7:141950091-141950113 GGTCATAGTGGAACTCAGACTGG - Intronic
1037983242 8:23270037-23270059 GGTGATAGTGAAAAGCAGACTGG - Intergenic
1040399458 8:47033808-47033830 GGGCATTGTGGGAGTCAGACTGG - Intergenic
1043868580 8:85403462-85403484 TGTCATAATAGAACTCAAACTGG - Intronic
1044227582 8:89736830-89736852 GGCCATGGTGGAAGTAAGACTGG + Intergenic
1046021443 8:108670235-108670257 GTTCATAGGGGAACTGAAACTGG - Intronic
1047442217 8:124888326-124888348 TGTCACAATGTAACTCAGACAGG - Intergenic
1048070185 8:131012719-131012741 GATCATAATGGAACTCATAATGG + Intronic
1048865608 8:138759297-138759319 GGTCATTGTCTGACTCAGACTGG - Intronic
1053231784 9:36416365-36416387 GGGCATGGTGGGACTGAGACCGG - Intronic
1053459303 9:38256305-38256327 TGACATAGTAGAACTCACACAGG - Intergenic
1059912625 9:119062843-119062865 AATCATTGTGGAACTCAGAAAGG - Intergenic
1060137682 9:121172925-121172947 GGTAATACTGGAAATCAGATTGG + Intronic
1061623257 9:131825132-131825154 GGGCAAAGTGAAACCCAGACAGG + Intergenic
1061875693 9:133542510-133542532 TGTCCTCGTGGAACTCAGCCTGG + Intronic
1187000042 X:15167329-15167351 GGTGGCAGTGGAACTCATACAGG - Intergenic
1190502239 X:51090795-51090817 GGTGATAATAGAACTCAGAAGGG + Intergenic
1190909473 X:54758228-54758250 GGTCATGGTGCAACCCAAACAGG - Exonic
1191920737 X:66254595-66254617 GATCATAGTTGAAGTCAGAAAGG + Intronic
1193022345 X:76803684-76803706 AGTCATGGTGGAAGGCAGACAGG - Intergenic
1193290076 X:79762380-79762402 GGTCATGGTGGGAGTGAGACTGG - Intergenic
1193479605 X:82010916-82010938 GCTCTGAGTGGAACCCAGACAGG + Intergenic
1193541287 X:82775582-82775604 GGGCATGGTGGGAGTCAGACCGG - Intergenic
1195734211 X:107996367-107996389 GGGCATGGTGGAAGTAAGACTGG + Intergenic
1196865830 X:120069933-120069955 AGTCATGGTGGAAGACAGACTGG - Intergenic
1196877266 X:120166347-120166369 AGTCATGGTGGAAGACAGACTGG + Intergenic
1198664706 X:139007955-139007977 GGGCATAGTGGGAGTGAGACTGG + Intronic
1200226463 X:154420380-154420402 GGACAGAGTGGAACATAGACAGG + Intronic