ID: 1033502238

View in Genome Browser
Species Human (GRCh38)
Location 7:141963535-141963557
Sequence ATAGAGATGCACAATGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033502238 Original CRISPR ATAGAGATGCACAATGATGA TGG (reversed) Intronic
902548577 1:17205891-17205913 ATGGTGATGAACAGTGATGATGG + Intronic
904174719 1:28618772-28618794 ATAAATATGCACAATGATAAAGG - Intronic
905625593 1:39488906-39488928 ATAGAAATGCTAAATGAGGAAGG + Intergenic
905639487 1:39578839-39578861 ATAGTGATTAACAATGTTGACGG - Intergenic
906463027 1:46051652-46051674 ATATAGGTACATAATGATGATGG - Intronic
908103239 1:60812934-60812956 ATAGGCAAGCACAAGGATGAAGG - Intergenic
908236249 1:62149969-62149991 ATAGATAGGCACAATTATAAGGG + Intronic
909128107 1:71700903-71700925 AAAGAGATGAAAAATGATAAAGG + Intronic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
911164783 1:94714839-94714861 ATGGAGATTTACAAAGATGAAGG - Intergenic
911606015 1:99906075-99906097 CTGGAGATGGACAGTGATGATGG - Intronic
911664064 1:100534424-100534446 ACAGAGATGGAGAAAGATGAAGG - Intergenic
913053877 1:115139846-115139868 AAAGAGATGCACAATTATTGTGG - Intergenic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
918268955 1:182877015-182877037 ATATAGATGCACAATAATTTTGG - Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918822498 1:189272891-189272913 ATAGAGTAGGACAATGATAATGG + Intergenic
918901654 1:190428776-190428798 ATAAATATGTACAATGATTATGG + Intronic
919287418 1:195581755-195581777 CTGGAGATGGACAATGTTGATGG - Intergenic
919297261 1:195718770-195718792 CTAGTGATTAACAATGATGATGG - Intergenic
920174903 1:204094603-204094625 ACAGAGATGAACAAAGATGCCGG + Intronic
922307698 1:224358222-224358244 CTAGATATGCACAATGAGAATGG + Intronic
923360507 1:233206400-233206422 ACAGAGATGCTCACTCATGATGG - Intronic
924234124 1:241986459-241986481 ATATAGATGCAGCATAATGATGG + Intergenic
1062845239 10:698317-698339 ATAGGGATGCAAAATGCTGTAGG + Intergenic
1062991130 10:1819921-1819943 ATAGAAATGAAGAATTATGAAGG + Intergenic
1064429578 10:15259113-15259135 ATAGATAGGGAGAATGATGATGG - Intronic
1064464244 10:15563274-15563296 ATACAGATGCCCAGTGATGGAGG + Intronic
1065054034 10:21825148-21825170 CTAGAGATGGACAGTGGTGATGG - Intronic
1068223444 10:54074268-54074290 TTAGAGATGGATAGTGATGATGG - Intronic
1068916714 10:62440650-62440672 ATAGAGATACACAATTAGTAAGG - Intronic
1070971105 10:80568010-80568032 ACAGAGAGGCACAGAGATGAAGG - Intronic
1071021478 10:81062075-81062097 CTAGAGATGAAGAATGGTGATGG - Intergenic
1072814608 10:98492905-98492927 ATAGAGATGGACAGTGGTGATGG - Intronic
1073607121 10:104907682-104907704 AAAGAGAGGCACAATGATACAGG - Intronic
1074584771 10:114756925-114756947 ATAGAGTTCCAGAGTGATGAAGG - Intergenic
1075918351 10:126189177-126189199 ATAGAGAAGGATCATGATGAAGG + Intronic
1075985327 10:126780088-126780110 ATAGAGATGGAAAGTGAGGAAGG - Intergenic
1077693829 11:4375277-4375299 ATAGAGTGGCCAAATGATGAAGG - Intergenic
1077842551 11:5991343-5991365 ATATAGATGGAAAATGATTAGGG - Intergenic
1080194355 11:29591333-29591355 ACAGAGAAGCACTATGCTGAGGG - Intergenic
1080809288 11:35686874-35686896 CTAGAGATGGACAGTGATGATGG - Intronic
1080858004 11:36129076-36129098 GTAGAGAGGAATAATGATGAGGG + Intronic
1081452476 11:43184835-43184857 ATAGACATGAACAAATATGAAGG + Intergenic
1084074944 11:66766650-66766672 ATAATGATGCAGAATAATGAAGG - Intronic
1085196570 11:74675961-74675983 GTAGAGATGGAGAATGATGGCGG + Intergenic
1086102423 11:83115081-83115103 ACAGAGAGGCAAATTGATGATGG + Intergenic
1086664914 11:89468384-89468406 ATATTGGTGCACAAAGATGATGG - Intronic
1088525159 11:110745131-110745153 ATAGAGATGGATGATGCTGATGG - Intergenic
1089917834 11:122176213-122176235 ACAGAGATCCCCAATGATAAAGG + Intergenic
1092601741 12:10073742-10073764 AAAGAGATGCAGAATGATTCTGG + Intronic
1094189558 12:27683620-27683642 CTAGAAATGTACAATAATGAAGG - Intronic
1096025607 12:48358528-48358550 ACTGAGATGTCCAATGATGACGG - Intergenic
1096082148 12:48840932-48840954 ATAGGAATGAAAAATGATGAGGG - Intronic
1099288798 12:80749200-80749222 ATACATATGCACAATTAGGAAGG - Intergenic
1099364421 12:81750189-81750211 AGAGAGATGAACATTAATGAAGG + Intronic
1099495746 12:83343677-83343699 ATAGAGATGCACAAGGACTTGGG + Intergenic
1100784210 12:98062161-98062183 ATAGAGAAACACAATGGTAAGGG + Intergenic
1101081246 12:101187256-101187278 ATAGAAATGTAAGATGATGATGG + Intronic
1104668094 12:130661834-130661856 ACAGAGATGCATACTCATGAAGG - Intronic
1106257867 13:28038095-28038117 ATAGCAATGAACAACGATGAGGG + Intronic
1107059300 13:36139350-36139372 ATAGAGATACACAAAGAAAACGG - Intergenic
1110581879 13:77139320-77139342 CTATAGATCCATAATGATGATGG - Exonic
1111942696 13:94629467-94629489 ATAGAGATGAGTAATAATGAAGG - Exonic
1112050008 13:95635854-95635876 AGAGAAATGCACAGTGATGATGG + Intronic
1112999924 13:105623140-105623162 ATAGATAAGGACAATGATTATGG + Intergenic
1114331316 14:21639794-21639816 ATAGAGCTGCACAATTGTGGAGG + Intergenic
1115889759 14:38013164-38013186 ATTGTGATCCACAATGCTGAAGG + Intronic
1118036623 14:61875421-61875443 AAAGAGATGGACAATTTTGAAGG + Intergenic
1120281844 14:82448912-82448934 ATAAAGATGCAAAATGACAATGG + Intergenic
1120346089 14:83292120-83292142 ATAGTGATGCACCAAAATGATGG - Intergenic
1125265956 15:37881400-37881422 GTAGTGATGGACAATGATGCAGG + Intergenic
1125435690 15:39642868-39642890 AGAGATATGCTCAATGATGGTGG - Intronic
1127185865 15:56480090-56480112 CTGGAGATGGACAATGGTGATGG + Intergenic
1128773000 15:70296621-70296643 ATAGAGGTGGACAAAGATGGGGG - Intergenic
1131471611 15:92702474-92702496 ATAAAGATGAATAATGATAATGG + Intronic
1131708269 15:95022672-95022694 ATAGAAATGCCCGAGGATGAGGG + Intergenic
1131778155 15:95824553-95824575 ACAGAGAATCACAATGTTGACGG + Intergenic
1131803162 15:96093681-96093703 AAACAGATTCACCATGATGAAGG + Intergenic
1138034916 16:53594388-53594410 ATAGAAGTGCAGAATGAAGAGGG - Intergenic
1138937302 16:61743479-61743501 ATAGAGATTCAAAAAGATAATGG - Intronic
1138969484 16:62127598-62127620 ATAGTGACTCACATTGATGAGGG + Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140816830 16:78628896-78628918 AGATAAATGCACAATGAGGAGGG - Intronic
1141793607 16:86253321-86253343 ATAGCGATGAATAATGGTGATGG + Intergenic
1142899577 17:3003828-3003850 AGAGAGGCGCACAATGAGGATGG + Intronic
1145893764 17:28438972-28438994 ATAGAGATGGATAGTGGTGATGG - Intergenic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1151142934 17:72012302-72012324 ATAAAGAAGCAAAATGATTAGGG + Intergenic
1151644509 17:75420902-75420924 CTGGAGATGGACAATGGTGATGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1158744360 18:60181483-60181505 ACAGAGATGAAAAATGGTGAAGG - Intergenic
1159000429 18:62969705-62969727 ATAGAGAGTCATAATGATAAAGG - Intronic
1159650009 18:70967005-70967027 ATAGAGCATCACAATTATGATGG + Intergenic
1161758259 19:6150752-6150774 CTAGAGATGAACAGTGGTGACGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166415160 19:42589874-42589896 AGACAGATGCACAATGATCGGGG + Intronic
925993705 2:9274687-9274709 ATAAATATGCACCATAATGAAGG + Intronic
926257893 2:11225211-11225233 ATAAAGATGGAAAATGTTGAAGG + Intronic
926502067 2:13668058-13668080 ATACAGATGGACAATGGAGAAGG + Intergenic
926531685 2:14055153-14055175 ATATATATACACAATGATAAAGG + Intergenic
928383091 2:30838087-30838109 CTGGAGATGAACAGTGATGATGG + Intergenic
930138815 2:47930994-47931016 ATAGAGATGGATACTGGTGATGG + Intergenic
931255512 2:60568832-60568854 CTAGAAATGCATAATGAGGATGG - Intergenic
931806522 2:65812513-65812535 ATATAAATGCATATTGATGATGG + Intergenic
935353084 2:102171688-102171710 ATAGAAATGCACAAAGAAAAAGG - Intronic
935451179 2:103211351-103211373 AGAGTCATGCACAATGATCAAGG + Intergenic
936111050 2:109665203-109665225 TTTGAGATGCAGAATGATGCTGG + Intergenic
936619300 2:114078501-114078523 ATAATGATACAAAATGATGAAGG - Intergenic
936931510 2:117794440-117794462 ATTGAGGTGCACATTGTTGATGG + Intergenic
937582613 2:123505980-123506002 ATAGAGATGAATAAACATGAAGG + Intergenic
938971929 2:136440431-136440453 AGAGAGCTCCACAGTGATGATGG + Intergenic
940000657 2:148963799-148963821 CAAGAGATGCAAAATGATGGGGG - Intronic
940283066 2:152007285-152007307 CTAGAGATGGATAGTGATGATGG - Intronic
940747623 2:157586641-157586663 ATATATCTGAACAATGATGAAGG + Intronic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
944031234 2:195237199-195237221 ATAGAGAAGCACAAATAAGAGGG - Intergenic
946886053 2:224224219-224224241 ATAGATTTGCAAAATGTTGAGGG - Intergenic
947361834 2:229353299-229353321 ACAGAGATACACAATGATGAAGG + Intergenic
947993012 2:234501663-234501685 ATAGAGATCGACAATTATTAAGG - Intergenic
1169571793 20:6914369-6914391 ATACAGATGCTCAATAGTGATGG - Intergenic
1169639657 20:7736413-7736435 AAAGAGATGGACAATGATTAAGG + Intergenic
1177284042 21:19024337-19024359 AACAAAATGCACAATGATGAGGG + Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1181646854 22:24235974-24235996 ATATAGATGCACAAGGACCATGG - Intronic
949171842 3:1009223-1009245 ATGTAGCTGCACAATGAAGAAGG - Intergenic
949820386 3:8109804-8109826 ATAGAGAGGCAAGATGATGTAGG + Intergenic
951276025 3:20687388-20687410 ATAGAGATGCACAAGATTCATGG - Intergenic
951418146 3:22449947-22449969 ACAGAGATGCAAAATCATGTAGG + Intergenic
955628310 3:60945064-60945086 AAAGAGATGGAGGATGATGAGGG + Intronic
955632732 3:60991920-60991942 ACAGAGATGCTCTATGCTGATGG - Intronic
956002549 3:64744884-64744906 ATAGATATGAAAAATGATTATGG - Intergenic
956341713 3:68231942-68231964 ATAAATATGCACAATTATTAAGG - Intronic
957663255 3:83188486-83188508 GTGGAGATGCACATGGATGAGGG + Intergenic
962036680 3:131659294-131659316 ATAAAGTTGCTTAATGATGAAGG - Intronic
963955612 3:151250358-151250380 CTAGAGATGCATGGTGATGATGG - Intronic
964236841 3:154541227-154541249 ATAGTGATGGACAATGGGGAAGG + Intergenic
971311450 4:25529007-25529029 ATAGATAAGCACAAAGATGGGGG - Intergenic
972455878 4:39254706-39254728 CTAGAGATGGACAGTGGTGATGG - Intronic
972796865 4:42430030-42430052 CTAGAGATGGACAGTGGTGATGG + Intronic
974516083 4:62913124-62913146 ATAGAGATACATAATGACAAGGG + Intergenic
976420815 4:84841749-84841771 ATAGAGATGCCTAATTACGAAGG + Intronic
978045132 4:104115919-104115941 ATAGAGAGGTAAAATGATCAAGG - Intergenic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
980122724 4:128744284-128744306 CTGGAGATGGACAATGGTGAGGG - Intergenic
981138087 4:141235981-141236003 ATAGAAATGTGCACTGATGATGG + Intergenic
983995697 4:174178941-174178963 ATAGAGATGTACTAAAATGATGG - Intergenic
986041764 5:4000611-4000633 ATAAAGATGGTAAATGATGAGGG + Intergenic
986102296 5:4625100-4625122 ATGGAGATGGATGATGATGATGG + Intergenic
988554169 5:32222004-32222026 ATTGTGAAGAACAATGATGATGG + Intergenic
989418989 5:41213432-41213454 ATAGGTATGCAGAATGAAGAGGG + Intronic
991649813 5:68840401-68840423 ATACAGACACACAAAGATGATGG + Intergenic
992263992 5:74999491-74999513 AAAGAGATGAACAAAGGTGAAGG - Intergenic
992536612 5:77711751-77711773 ATAGACAAGCACAATGAAGTAGG - Intronic
992794486 5:80243488-80243510 ACACAGATGCACACTGAAGAGGG + Intronic
993658164 5:90597881-90597903 ATAGAGATGGATAATTTTGAGGG + Intronic
994835183 5:104843038-104843060 ATAGAGATACAAAATGCTTAAGG - Intergenic
995448974 5:112279494-112279516 TTGGAGATGGACAGTGATGATGG + Intronic
995626497 5:114082971-114082993 ATAGAGATGGATAGTGGTGATGG + Intergenic
995737679 5:115319951-115319973 AGGGAGATGCACAAAGATTAAGG + Intergenic
998371036 5:141661686-141661708 ATAGAGATGCCCAATGAGGGTGG + Exonic
999582409 5:153053842-153053864 ATAGAGATTGACAATGGTGATGG - Intergenic
999883497 5:155893556-155893578 CTAGAGAGGCATAATGAAGATGG + Intronic
1001884894 5:175280559-175280581 CCAGAGATGCACAGTGATGCAGG - Intergenic
1005278360 6:24243864-24243886 AGAGAGATGAACAAACATGAGGG + Intronic
1005866152 6:29938878-29938900 AGAGAAATGCACAATGAAGCAGG - Intergenic
1006611060 6:35294815-35294837 ACAGAGACACAAAATGATGAAGG - Intronic
1006808331 6:36803349-36803371 TTAGAGATGCAGGAGGATGATGG - Intronic
1008197128 6:48538111-48538133 ATGGGGATGCACAGTGCTGAGGG + Intergenic
1011435955 6:87336960-87336982 TCAGAGAAGCACAATTATGAAGG + Intronic
1011749096 6:90437539-90437561 CTAGAGATGGACGGTGATGATGG - Intergenic
1011853223 6:91656132-91656154 ATACAGATGCACAAAGTTGGTGG - Intergenic
1012604878 6:101145400-101145422 AAAGAGATAGAAAATGATGATGG + Intergenic
1013938132 6:115624388-115624410 ATAGAAATGCACAATTATAATGG - Intergenic
1015981599 6:138845191-138845213 AAGCAGATGCACAATGGTGATGG - Intronic
1016037986 6:139402834-139402856 AAAGAGATTCAGAATAATGATGG - Intergenic
1016177079 6:141093549-141093571 AAAGAGAAGAACAAAGATGAAGG - Intergenic
1017203323 6:151778302-151778324 CTGGAGATGGACAATGGTGATGG + Intronic
1017436249 6:154418272-154418294 AGAGAAAGGCAGAATGATGACGG - Intronic
1017587379 6:155941964-155941986 ATAGCTTTGCAGAATGATGACGG - Intergenic
1018536570 6:164826850-164826872 ATAGATATGCACATTGAAAAGGG + Intergenic
1019009853 6:168835516-168835538 ATAAAGATGCACAATTATTATGG - Intergenic
1019871897 7:3771469-3771491 ATACATATGCACAACAATGAGGG - Intronic
1020218230 7:6212352-6212374 CTAGAGATGGATAGTGATGATGG - Intronic
1020863383 7:13523283-13523305 ATAAAGAGGAACAATGATCAGGG + Intergenic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021772329 7:24017724-24017746 CTAGAGATGGACAGTGGTGATGG + Intergenic
1022913277 7:34920766-34920788 ATAGACATCCACATTGATGTGGG - Intergenic
1023307525 7:38846748-38846770 AAAGACATGAACAAGGATGATGG + Intronic
1024071753 7:45792090-45792112 ATAGACCTGAACAATGAAGATGG + Intergenic
1025090447 7:56058831-56058853 CTAGAGATGGACAGTGCTGACGG - Intronic
1025832824 7:65068935-65068957 CTAGAGATGGACAGTGCTGATGG - Intergenic
1025902595 7:65758458-65758480 CTAGAGATGGACAGTGCTGACGG - Intergenic
1026333832 7:69376978-69377000 AAAGAGATGCAGAAAGATGTAGG - Intergenic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1028819777 7:95194832-95194854 ATAGAGATACACCATGTTCAGGG + Intronic
1032716259 7:134511656-134511678 CTAGAGAGGCACAATGACTATGG + Intergenic
1033216750 7:139499097-139499119 AGAGATCTTCACAATGATGATGG + Intergenic
1033502238 7:141963535-141963557 ATAGAGATGCACAATGATGATGG - Intronic
1037309617 8:17541126-17541148 ACAGAGATGTACAAAGATCAAGG - Intronic
1039862284 8:41469162-41469184 AAAGTGATGGACAATGATGGCGG - Intergenic
1041405949 8:57499455-57499477 AGAGAGATGAACAAAGTTGATGG + Intergenic
1044348617 8:91136587-91136609 CTAGAGATGGATAATGCTGATGG - Intronic
1044501341 8:92962330-92962352 ATACATATGCACAAAGATTAAGG + Intronic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1046845859 8:118914894-118914916 ATAGAGCTCCACATTGGTGAAGG + Intergenic
1047147878 8:122225905-122225927 ATAGAGATGAACTATGTTCATGG + Intergenic
1047161752 8:122388309-122388331 CTAGAGATGGACGATGGTGATGG - Intergenic
1047834073 8:128669191-128669213 ATTGAGACTCACATTGATGATGG + Intergenic
1049955845 9:692044-692066 ACAGAGATCAACAAAGATGACGG + Intronic
1052483406 9:29062744-29062766 CTAGAGATGGATAGTGATGATGG + Intergenic
1058267013 9:102913747-102913769 ATAAAGATGCACCATGTTCATGG + Intergenic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1060710605 9:125860098-125860120 ATACAGATCCACAATGAATATGG - Intronic
1062170466 9:135132176-135132198 AACGAGATGCACCATCATGATGG + Intergenic
1188063001 X:25623991-25624013 ACAGACATGAATAATGATGATGG - Intergenic
1188150128 X:26663493-26663515 ATAGAAATGCAAAGTGATAAAGG + Intergenic
1192150196 X:68707311-68707333 ATAGACATTCACACTGATGCTGG + Intronic
1194703687 X:97148132-97148154 ACTGAGATGCAGAATGATAAAGG + Intronic
1196606053 X:117658310-117658332 CTAGAGATGGATAGTGATGATGG + Intergenic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198971353 X:142284042-142284064 GTATAGTTGCACATTGATGAAGG + Intergenic
1201168078 Y:11229539-11229561 ATAGACATGCACCATCATGCTGG + Intergenic
1201752986 Y:17454325-17454347 ATAGAAATGCACAACAATGTTGG + Intergenic