ID: 1033503322

View in Genome Browser
Species Human (GRCh38)
Location 7:141975993-141976015
Sequence GTAGTGTCAATAGGAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033503322 Original CRISPR GTAGTGTCAATAGGAAACAC TGG Intronic
902036776 1:13463693-13463715 TGAGTTTCAATAGGAAACACGGG - Intergenic
903674999 1:25058004-25058026 ATAGTGTCAGTAGAAAGCACGGG + Intergenic
905560636 1:38924291-38924313 GTACTCTTAAAAGGAAACACAGG + Intronic
907643398 1:56215625-56215647 TTAGTTTGTATAGGAAACACCGG - Intergenic
907924144 1:58940257-58940279 GTAGTGTCAATAGGGAGTTCAGG - Intergenic
907974560 1:59418929-59418951 GTATTGTCCCTAGGAAACCCTGG - Intronic
909151510 1:72011680-72011702 ATAGTGTGAAAAGGAAACATCGG + Intronic
909504468 1:76372573-76372595 TCAGTGTCAATGGGAAAAACTGG + Intronic
910008415 1:82429897-82429919 AGAGTGTCAGTTGGAAACACTGG - Intergenic
910032976 1:82753741-82753763 GTGATGTAAATAGGAAATACTGG - Intergenic
911223674 1:95279466-95279488 GTGGTGTTAATGGGAATCACTGG + Intergenic
913156462 1:116104454-116104476 GTACTGTCTATAATAAACACAGG - Intergenic
918911657 1:190580305-190580327 GTTCTGATAATAGGAAACACTGG + Intergenic
920587515 1:207181390-207181412 GTAGTGTCCATGGGCAATACTGG - Intergenic
920644801 1:207793217-207793239 GTAGGGCCAATGGGAAAGACTGG - Intronic
923393575 1:233537801-233537823 GTAGTCCCAAAAGGAAACAAGGG + Intergenic
1069218861 10:65857165-65857187 GAATTGTCAATAGAAAACAATGG - Intergenic
1071754577 10:88522557-88522579 ATATTTTCAATAAGAAACACAGG + Intronic
1071879144 10:89875574-89875596 TTAGTGTCAATAGGAATGACAGG - Intergenic
1086825398 11:91489722-91489744 GTAGTATGAAAAGGAACCACTGG + Intergenic
1090805943 11:130202292-130202314 CTAGTGTCAATAGTAACCAGGGG - Intronic
1090865377 11:130696018-130696040 CTGGTGCCAATAGGAACCACAGG + Intronic
1096669176 12:53188202-53188224 GTAGGGACAAAAGGAAAAACGGG + Exonic
1099040508 12:77647741-77647763 GTAGTGTCAATGGGAAAAAATGG - Intergenic
1099454765 12:82850336-82850358 GTAGTGTTAATAGAAGACCCTGG + Intronic
1099560152 12:84163233-84163255 GTAGTTTAAAAAGCAAACACCGG - Intergenic
1100067833 12:90671815-90671837 ATAGGGTCAACAAGAAACACAGG - Intergenic
1103229785 12:119319789-119319811 GTTGAGTCAATAGGAGGCACTGG + Intergenic
1109271462 13:60260504-60260526 GTAGTGTCAACAGAGACCACAGG - Intergenic
1110954302 13:81534703-81534725 TTAGAGTTAATAGGAAAAACAGG - Intergenic
1114146571 14:19984193-19984215 GTTGTGTCAAAAGAGAACACGGG + Intergenic
1116532838 14:45994143-45994165 TTAGTTTTTATAGGAAACACAGG - Intergenic
1117692498 14:58322455-58322477 GATGTGTCAAAAGGAAATACAGG + Intronic
1120355790 14:83432014-83432036 GAAGTGTTCATAGGAAACTCTGG + Intergenic
1120375131 14:83695209-83695231 GTAGTGTCCAGAGGCAGCACAGG + Intergenic
1125240059 15:37564218-37564240 GTAGTGACAACACCAAACACTGG + Intergenic
1126462155 15:48925846-48925868 ATGGTGTCAATAGGAAGGACGGG + Intronic
1128093838 15:64937982-64938004 GTTGTGTCAAAAGGACACAGGGG + Intronic
1128477052 15:68006304-68006326 GCAGTGTCAAGAGGAAATATAGG + Intergenic
1133460253 16:5981221-5981243 GAAGGGTCAACAGGAAAGACAGG + Intergenic
1135222423 16:20624357-20624379 GGAGTGGGAATTGGAAACACAGG - Intronic
1139565390 16:67772311-67772333 GTTGTGTCACTATGAACCACCGG + Intronic
1153352957 18:4101743-4101765 ATATTGGCATTAGGAAACACTGG - Intronic
1157233785 18:45943951-45943973 GTAGTGGCAAGTGTAAACACAGG - Intronic
929418853 2:41770574-41770596 ATAGTGGGAAGAGGAAACACAGG - Intergenic
930050745 2:47214460-47214482 GTACCATCAATAGGCAACACAGG + Intergenic
931177477 2:59868501-59868523 GTAAAGTCAACAGAAAACACAGG + Intergenic
935624606 2:105161607-105161629 GTACTGACAATAGCAAATACTGG + Intergenic
936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG + Intronic
936607610 2:113973801-113973823 GAAGTGTTAATAAGAGACACTGG + Intergenic
941544958 2:166837667-166837689 ATAGTATCAATGGGAAACAGAGG + Intergenic
941766441 2:169302327-169302349 GTATTTTCATTAGGAGACACAGG - Intronic
942728654 2:179039004-179039026 GTAATGTCAATAGTAGCCACAGG + Intronic
946369591 2:219272556-219272578 GTAGAGTCATCAGGAAACCCTGG + Intronic
947140312 2:227014168-227014190 GCAACATCAATAGGAAACACAGG + Intronic
948108049 2:235430786-235430808 GTGGTGTCAAGAAGGAACACTGG - Intergenic
1169793147 20:9432891-9432913 GTAGTGTCTGGAGGAGACACAGG - Intronic
1173314661 20:41932513-41932535 GCAGTGTCATGAGGAAGCACAGG - Intergenic
1175726042 20:61319285-61319307 GTAGGGCCAAAAGGACACACTGG + Intronic
1176272336 20:64242403-64242425 GTAGTTTCAAAAGGAGATACTGG - Intergenic
1178801712 21:35801538-35801560 GTAGTGTGGAGAGGAAACAGTGG - Intronic
1181087563 22:20448864-20448886 GTAGTGAAAATACGAAATACTGG - Intronic
949694588 3:6680025-6680047 ACAGTGTCAATAGCAAACACTGG + Intergenic
950297603 3:11845646-11845668 GTAGTGTAAGTGGGAAACAGAGG + Intronic
951634242 3:24755643-24755665 ATTCAGTCAATAGGAAACACAGG + Intergenic
951915687 3:27798556-27798578 GTAGTCACAAAAAGAAACACCGG + Intergenic
952131999 3:30374674-30374696 GTAGTGTCTGGAGGGAACACAGG + Intergenic
954632513 3:52055189-52055211 GGAATGTTAATTGGAAACACCGG + Intronic
957613398 3:82498086-82498108 GTTGTAGCAATAGGAAACTCCGG + Intergenic
964862635 3:161219536-161219558 GCAGTGTGAATAGAAAAAACGGG + Intronic
969997869 4:11333017-11333039 GAAATGCCAATAGAAAACACTGG + Intergenic
971174208 4:24265263-24265285 GTTCAGTGAATAGGAAACACTGG - Intergenic
974374230 4:61056124-61056146 GTAGTGTCAAGAGAATACAGTGG + Intergenic
974393499 4:61305468-61305490 GTAGTTGCTGTAGGAAACACTGG + Intronic
980674766 4:136062773-136062795 GTAGTGTTAATAGGACAAACAGG + Intergenic
981227748 4:142316925-142316947 GAAGTCTCAACAAGAAACACTGG - Intronic
982057323 4:151565073-151565095 GTAATGTCAAAAGAAAACAGGGG - Intronic
984514406 4:180720387-180720409 GTAGTGTTAATAATAAACAATGG + Intergenic
991024050 5:62010815-62010837 GTAGTGTCATTAGGCAAGAAAGG + Intergenic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
993116778 5:83728524-83728546 AGTGTGTCAATAAGAAACACTGG - Intergenic
994860716 5:105189181-105189203 ATAGTGTCAATGGTAAATACAGG + Intergenic
997786008 5:136714719-136714741 GCAGGGTGAATAGAAAACACAGG - Intergenic
1001741276 5:174054894-174054916 CTAGTGTCATGAGGAAACAGAGG - Intronic
1003093503 6:3123967-3123989 GTACTTGCAATAGGAAAAACTGG - Intronic
1008739584 6:54589492-54589514 GTAGTGTGAATGGGGATCACAGG + Intergenic
1009539261 6:64930767-64930789 GTAGTGTCCATAAGAAAAGCAGG + Intronic
1010276127 6:73970686-73970708 GGAGTGTCAAGTGGAAGCACCGG - Intergenic
1010639876 6:78311521-78311543 GTAAAGTCAAAAGCAAACACTGG + Intergenic
1011140073 6:84143891-84143913 ATAGAGACCATAGGAAACACAGG - Intronic
1016918535 6:149267315-149267337 GTTCTGACAATAGGAGACACGGG - Intronic
1027139948 7:75649901-75649923 GCAGTGTCAGGAGGAAAAACAGG - Intronic
1028939258 7:96502381-96502403 GTAGTGGCAGTCTGAAACACTGG + Intronic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1033503322 7:141975993-141976015 GTAGTGTCAATAGGAAACACTGG + Intronic
1039006048 8:33038320-33038342 CTAGTGTTGGTAGGAAACACAGG - Intergenic
1041846069 8:62330409-62330431 GTAGTGGCAGTAGGAAAGAGAGG + Intronic
1042212003 8:66390189-66390211 TTGGTGTGAATAGAAAACACTGG + Intergenic
1043284674 8:78514512-78514534 ATGATGTCAATAGGAGACACTGG + Intergenic
1043788738 8:84435830-84435852 GTAGGGTGAGTAGGAAAGACTGG - Intronic
1048659626 8:136583816-136583838 GTAGTGTCAAAATCAGACACAGG + Intergenic
1048829576 8:138463310-138463332 GCAGTGACAGTAGGAAAGACAGG + Intronic
1058394893 9:104539769-104539791 GAAATGGCCATAGGAAACACTGG + Intergenic
1058466849 9:105237454-105237476 GTAATGTAGATAGGAAAAACTGG + Intergenic
1060578730 9:124723570-124723592 TTTGTGTCATTAAGAAACACAGG + Intronic
1187147700 X:16652641-16652663 GTTGTTTCAAAAGGTAACACGGG + Intronic
1187921119 X:24202896-24202918 GCTGTGTCAATGGGAAAGACGGG + Intronic
1194477226 X:94373237-94373259 GGAGAGGCAATAGCAAACACTGG + Intergenic
1195146929 X:102027266-102027288 GCAGTGGCAATAGGATAGACAGG - Intergenic