ID: 1033514591

View in Genome Browser
Species Human (GRCh38)
Location 7:142093565-142093587
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 2, 1: 0, 2: 4, 3: 34, 4: 323}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033514591 Original CRISPR AGGTTGTGACAGCTGGAGAA GGG (reversed) Intronic
900277732 1:1843032-1843054 TGGCTGTTACAGCTGGGGAAAGG - Intronic
901451368 1:9338615-9338637 AGTTGGTCACAGCTGGAAAAGGG + Intronic
901799910 1:11701993-11702015 AGTGTGTGTCAGCTGGAGGAGGG - Intronic
902202752 1:14845816-14845838 AGCTGGAGACAGCTGGAGAGTGG + Intronic
902249578 1:15145348-15145370 TGATTGTCACAGCTGGGGAAAGG + Intergenic
902340212 1:15778180-15778202 GGGTTGTTACAACTGGAGGAAGG + Intronic
903165329 1:21516214-21516236 AGGTGGAGACAGGTGGAGACAGG - Intronic
903269047 1:22176505-22176527 AGGTGCTGGCAGCTGGAGAGTGG + Intergenic
903561984 1:24235047-24235069 TGTTTGTTACAGCTGGAGATGGG + Intergenic
903935944 1:26894940-26894962 AGGTTTTGTCATCTGTAGAATGG - Intronic
904295316 1:29516521-29516543 AGGATGGCCCAGCTGGAGAAAGG - Intergenic
905693047 1:39956463-39956485 AGGTTGTGGCAGCTGGTGCCGGG + Intronic
906698271 1:47839466-47839488 AGGTAGTGTCAGCTTGATAAAGG - Intronic
906731320 1:48083791-48083813 TGGTTGTCACAACTGGAGAGTGG + Intergenic
907825912 1:58016741-58016763 AGCTTATTACAGATGGAGAATGG - Intronic
912331312 1:108822517-108822539 AGGATGTGGCAGCTGGAGGTGGG + Intronic
913702264 1:121384732-121384754 AGGCTCTGACAGGGGGAGAAGGG - Intronic
915311810 1:155008914-155008936 AGGTTGGGACAGGTGGGGGAGGG - Intronic
915655727 1:157358536-157358558 AGATTGTGACAGCAGAAGAGAGG + Intergenic
916018274 1:160769985-160770007 AGATTGAGCCAGATGGAGAAAGG + Intergenic
916688527 1:167169703-167169725 AGGGTGTGCCAGCTCCAGAAGGG + Intergenic
916730654 1:167563813-167563835 AGGCTGTGACAACAGAAGAAGGG + Intergenic
917758159 1:178124310-178124332 TGGTTGTCACAACTGGAGTAGGG + Intronic
923584381 1:235253380-235253402 AGGTTGTCACAGCTGGGAAGGGG - Intronic
924395924 1:243620642-243620664 ACAGTCTGACAGCTGGAGAATGG - Intronic
924430415 1:243991698-243991720 TGGTTGTGACAACTGGAAGAGGG - Intergenic
924497604 1:244605266-244605288 AGGATGTGATGGATGGAGAAAGG - Intronic
1063378512 10:5569424-5569446 ACTTTATGACAGATGGAGAAGGG - Intergenic
1063584422 10:7338786-7338808 AGGATGTGTCCGCTGGGGAATGG - Intronic
1063584595 10:7340452-7340474 AGGTTGTGTTAGCTGGGGAATGG - Intronic
1063666736 10:8065651-8065673 AGGTTGAGAAAGTTGGAGAAGGG - Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1066002815 10:31120116-31120138 AAGTTGTGATTTCTGGAGAAAGG - Intergenic
1068938892 10:62661726-62661748 CGATTGTGAGAGCTGGTGAAGGG + Intronic
1070158357 10:73850469-73850491 TGGTTGTCACAACTGGAGGAGGG + Intronic
1070406851 10:76104875-76104897 TGGTTGGGACAGATTGAGAAAGG - Intronic
1070424908 10:76277071-76277093 AGAGTGAGAGAGCTGGAGAAGGG - Intronic
1072739939 10:97903291-97903313 GGTTTGTCACAGCTGGGGAAGGG - Intronic
1073433013 10:103499116-103499138 TGGTTGTGACAGTTGTAGGAAGG + Intronic
1073546582 10:104354321-104354343 AGGGTGTGACAGGTGGACAAGGG - Intronic
1075408024 10:122207485-122207507 TGGTTGTCACAGCTGGGGTAAGG + Intronic
1077463435 11:2722241-2722263 AGGTGTTGACAGGTGGAGAGAGG + Intronic
1078542306 11:12222200-12222222 TGGCTGTGACAGCTGGTGGACGG + Intronic
1079092978 11:17493714-17493736 AGGTTGAGAAAGCAGGAGATGGG - Intergenic
1079188083 11:18254947-18254969 AGGATGTGAGAGCTCGATAAAGG - Intergenic
1081672237 11:44948945-44948967 AGGTCATGACAGCTGGACATGGG + Intronic
1081732202 11:45379522-45379544 TGGTTCTGAGAGCTGGAGTAAGG - Intergenic
1083649926 11:64196769-64196791 AGGGTGTCTCAGCTGGAAAAAGG + Intronic
1083998592 11:66284081-66284103 AGGTTGGGGCAGATGGAGACAGG - Exonic
1084736432 11:71108510-71108532 TGGTAGGGACATCTGGAGAAGGG - Intronic
1084958686 11:72704662-72704684 AGGCTGTGACAGCTGGGGATGGG + Intronic
1085812370 11:79695727-79695749 AGGTTGTGACCACCTGAGAAGGG + Intergenic
1085824091 11:79824754-79824776 AGGATGTGGCACCTTGAGAAAGG - Intergenic
1087050889 11:93885389-93885411 TGGTTATGAGAGCTGGGGAAGGG + Intergenic
1089173211 11:116529884-116529906 AGTTTGTCACAGCAGGGGAAGGG + Intergenic
1089200691 11:116723061-116723083 AGGCTGTGGCTGCTGGGGAATGG - Intergenic
1089625106 11:119746113-119746135 ACGTTGTGCCAGCTGGACTATGG - Intergenic
1089689508 11:120178574-120178596 GGTTTGTGAATGCTGGAGAATGG - Intronic
1089873827 11:121700997-121701019 AGGTGGTGACAGCAAGAGTAGGG - Intergenic
1090843895 11:130515248-130515270 AAGGGGTGGCAGCTGGAGAAGGG - Intergenic
1091232683 11:133998889-133998911 ATGGTGTGGCACCTGGAGAAGGG + Intergenic
1091631841 12:2167723-2167745 TGGTTGGGGCAGCTGGAAAATGG - Intronic
1092267643 12:6995152-6995174 ATGTTGTGTGACCTGGAGAATGG - Intronic
1093887943 12:24485032-24485054 AGGTTCGGACAGATGGAGAAAGG + Intergenic
1094549578 12:31437868-31437890 AGGTTGGGGGAGCAGGAGAACGG - Intronic
1094641961 12:32284235-32284257 AGGTGGAGAAAGCTGGAGAGAGG - Intronic
1095240642 12:39854777-39854799 AGCTTGATACTGCTGGAGAAAGG - Intronic
1096084485 12:48856608-48856630 TGGGTGTGATAGCTGGAGAGTGG + Intergenic
1096658187 12:53104767-53104789 AGGGAGTGACAGCAGGAGCAAGG - Intronic
1097173773 12:57131164-57131186 AGGCTGTGATAGCAGGAGGAAGG - Intronic
1097867282 12:64569314-64569336 GGGCTGTGTCAGCTGGAGCAGGG - Intergenic
1098728376 12:73999036-73999058 TGTTTGTCACAGCAGGAGAATGG - Intergenic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099244486 12:80179050-80179072 AGTTTGTGAAAGCAGGGGAAAGG + Intergenic
1099544154 12:83955593-83955615 AAGGTGTGACAGCTAGAAAAGGG - Intergenic
1099788661 12:87301178-87301200 AGGTTGTGAGAGCATGAAAAGGG + Intergenic
1101751712 12:107587362-107587384 AGATGCTGACAGCTGGAGGAAGG + Intronic
1102909194 12:116699706-116699728 GGGTGGTGGCGGCTGGAGAAGGG - Intergenic
1104477084 12:129079592-129079614 AGGTCGAGAAAGCAGGAGAATGG - Intronic
1106086666 13:26548799-26548821 AAGTAGAGACAGCTGGAGAAGGG - Intergenic
1106197215 13:27504205-27504227 ATCTTGTCTCAGCTGGAGAAGGG + Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108682883 13:52794431-52794453 AGTGTCTGAAAGCTGGAGAAGGG - Intergenic
1108997695 13:56755623-56755645 AGATTGTGACAGAAAGAGAAGGG + Intergenic
1109224761 13:59679585-59679607 AGGTTCTGACAGCAGGAAAATGG + Intronic
1110039835 13:70739870-70739892 AGGCCATGACAGCTGGAAAATGG + Intergenic
1111230340 13:85337318-85337340 AGGTGGTGGAAGATGGAGAAGGG + Intergenic
1112023841 13:95394671-95394693 AGGTTATGGGAGCAGGAGAAGGG + Intergenic
1112748522 13:102554747-102554769 TGGTTGTCACAACTGGAGAGAGG + Intergenic
1112991819 13:105523216-105523238 ACCTTGTATCAGCTGGAGAAAGG + Intergenic
1113825015 13:113245762-113245784 TGGTGGTGACACCTGAAGAAGGG + Intronic
1115524660 14:34267702-34267724 AGGTGGTGAAGGATGGAGAATGG - Intronic
1115973448 14:38971402-38971424 AAATCCTGACAGCTGGAGAAAGG + Intergenic
1118003853 14:61547917-61547939 ATGCTGTGACATCTGAAGAAAGG - Intronic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1119198170 14:72732753-72732775 AGTTTGGGACACCTGGAGGAAGG - Intronic
1119346915 14:73933264-73933286 TGGTTGTCACAGCTGGGGAGAGG + Exonic
1119632842 14:76248961-76248983 AGCTGGTGACAGTTGGAAAAGGG + Intronic
1120916784 14:89717568-89717590 AGGTAGTAAAAGCTGGAAAATGG - Intergenic
1121078902 14:91091618-91091640 AAGTTCTGACAACTGGACAAAGG + Intronic
1122673588 14:103391138-103391160 TGGTTATCACAGCTGGAGAAAGG + Intronic
1124383774 15:29189303-29189325 AGCTGGTGTCTGCTGGAGAATGG + Intronic
1124661460 15:31553867-31553889 AGATTCTGGCTGCTGGAGAATGG - Intronic
1126606677 15:50484963-50484985 TGGTTGTCAGAGCTGGAGAAAGG + Intronic
1126692630 15:51299497-51299519 TGGTCAGGACAGCTGGAGAATGG + Intronic
1126860595 15:52879017-52879039 AGGATGAGACAACTGGAGAAAGG - Intergenic
1128340789 15:66821320-66821342 GGGCTGGGACAGCTGGAGGAAGG + Intergenic
1129249702 15:74302215-74302237 GGGTGGGGACAGCTGGGGAAGGG - Intronic
1129253387 15:74320623-74320645 GGGTGGTGACAGGTGGAGAAGGG + Intronic
1129754107 15:78085594-78085616 TGCTCATGACAGCTGGAGAAGGG - Intronic
1130349971 15:83082949-83082971 AGGCTGAGCCAGCTGGAGAGTGG + Intergenic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1131069042 15:89452911-89452933 AAGTTGTGCCAGCTGTAGACTGG + Intergenic
1132953650 16:2579178-2579200 TAGTTGTCACAGCTGGAGCAGGG + Intronic
1132958669 16:2610296-2610318 AGGCTGTGACCCCTGGAGATGGG + Intergenic
1132960701 16:2620989-2621011 TAGTTGTCACAGCTGGAGCAGGG - Intergenic
1133826405 16:9282032-9282054 AGGTGGTCAGCGCTGGAGAAGGG - Intergenic
1134134320 16:11669109-11669131 AGGGGGCGACAGCTGGAGAGGGG - Intronic
1134341631 16:13352062-13352084 AGGATGTGATAGCTGAAGGAGGG + Intergenic
1134377462 16:13690760-13690782 AGGGTGGGTCAGCTGGAGACTGG - Intergenic
1135134041 16:19874661-19874683 GGGTTGTCACAGTTGGAGGAGGG - Intronic
1136548818 16:30970808-30970830 AGGTGGTGGCAGCTGGGGAGCGG - Intronic
1139021301 16:62753157-62753179 AGCTTTTGACAGCTGAAGGATGG - Intergenic
1140083081 16:71768811-71768833 AGGCTGAGGCAGCAGGAGAATGG + Intronic
1140733526 16:77877406-77877428 AGGCTGAGGCAGCAGGAGAATGG + Intronic
1141764226 16:86048090-86048112 TGGTTGTCACAGGCGGAGAAGGG + Intergenic
1142426569 16:90004754-90004776 AGGCTGCTGCAGCTGGAGAATGG + Intergenic
1142608848 17:1096879-1096901 AGGAGGAGACAGCTGGGGAAGGG + Intronic
1144100891 17:11941337-11941359 AGGTTGGGACAGAGGGAGAGAGG - Intronic
1145277477 17:21441655-21441677 CGGTTGTGACAAATGGAGGAAGG - Intergenic
1145315314 17:21727550-21727572 CGGTTGTGACAAATGGAGGAAGG - Intergenic
1146573017 17:33968897-33968919 GGCTTGTGACAGGTGGTGAAGGG + Intronic
1146749025 17:35360713-35360735 AGGTGGTGGCAGTTGGAGAGGGG - Intronic
1146887172 17:36479849-36479871 TGGTTGTCACAACTGGAGAGGGG - Intergenic
1148611443 17:48967299-48967321 GGGTTCTGAAAGCTGGAGAGGGG + Intronic
1149287150 17:55177294-55177316 AGGGTGTTACAGCCAGAGAAGGG - Intergenic
1149337551 17:55651956-55651978 AGGTTCTGACAGATTGAGAAAGG + Intergenic
1149441470 17:56678127-56678149 AGGCTGTGTCAGCTCAAGAAAGG + Intergenic
1150152141 17:62818769-62818791 AGGTTGTGAGAGTTGGAGTCAGG + Intergenic
1150962877 17:69934271-69934293 GGGTTGTTACAACTGGGGAAGGG - Intergenic
1150977499 17:70104946-70104968 AGGTGCTGACAGCTTCAGAAGGG + Intronic
1151440371 17:74124828-74124850 TGGTTGTCATAGCTGCAGAAGGG - Intergenic
1151522807 17:74642505-74642527 GGGTGGTGCCAGCAGGAGAAAGG - Intergenic
1152294048 17:79456428-79456450 GGGTTGTCACAGCTGGGGAGGGG - Intronic
1152422718 17:80202785-80202807 TGGTTGTCACAGCTGGGGCATGG - Intronic
1152467033 17:80472327-80472349 AGGGTGTAACAGCTAGAGATGGG - Intronic
1153814309 18:8779614-8779636 AGGTCGAGGCAGCTGGAGCAGGG - Intronic
1154198482 18:12282947-12282969 AGCTGGTGTCTGCTGGAGAACGG + Intergenic
1155440962 18:25862246-25862268 AGTATGTGGCAGCAGGAGAAGGG + Intergenic
1156183912 18:34639309-34639331 TGGTTGTCACAACTGGAGACAGG - Intronic
1156259161 18:35428625-35428647 GGGTTCTGACAGTTGGAGGAGGG - Intergenic
1156477484 18:37415173-37415195 TGGTTGGGTCAGATGGAGAAGGG + Intronic
1156579632 18:38359858-38359880 AGGCTGTGTCAGATGGAGTAAGG - Intergenic
1159936741 18:74374605-74374627 AGGCTGTGACAGCAGGACAGAGG + Intergenic
1160277718 18:77453310-77453332 TTGCTGTGACAGCTGGAAAACGG + Intergenic
1160955872 19:1691523-1691545 TGGAGGTCACAGCTGGAGAAGGG - Intergenic
1163110504 19:15158083-15158105 TGGTTGTCACAACTGGAAAAGGG + Intergenic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1165642090 19:37398358-37398380 AACATGTGACAGCTGAAGAATGG - Intergenic
1165856810 19:38883855-38883877 TGGTGGGGACAGGTGGAGAAGGG + Intronic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1166496117 19:43304492-43304514 AGGATGTGCCATCTGGAGAAAGG + Intergenic
1166693648 19:44839665-44839687 GGGTGGTGACAGCGGGAGCAGGG - Intergenic
1167699738 19:51035373-51035395 AGGCTGTGAAAGCAGGAGAGTGG + Intergenic
1167728465 19:51235326-51235348 GGGCTGTGAGGGCTGGAGAAAGG + Intronic
1168272410 19:55257595-55257617 AGGAGGTGACAGATGGAGAGTGG - Intronic
1168292356 19:55362767-55362789 AGGCTGTGGCTGCTGGAGGAAGG - Intronic
1168434183 19:56304392-56304414 TGGTTGTGACAGCTGGAGGAGGG + Intronic
926233752 2:11024030-11024052 TGGTAGTGACAGCTGGAGGCAGG - Intergenic
927317913 2:21707152-21707174 TGGTTGTCACAGCTGGGGACAGG + Intergenic
927452459 2:23220760-23220782 GGGCTTTGAAAGCTGGAGAATGG - Intergenic
927712848 2:25336405-25336427 AGGATGTGGCAGGTGGAGAAGGG - Intronic
928062755 2:28131508-28131530 ATTTTGTGACAGCTGGTGAGTGG - Intronic
929916288 2:46138703-46138725 TGGTTGTCACAGCTGGAGAGGGG + Intronic
930180847 2:48355278-48355300 AGGAAGTGAGAGCTAGAGAATGG + Intronic
934060293 2:88286160-88286182 AGGCTGTGACAGCTAGAGAAAGG + Intergenic
936083178 2:109449059-109449081 AGGCTGTGAGTGCTCGAGAAGGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938948381 2:136235047-136235069 AGGTTGTGAGAGCAGGACAAAGG + Intergenic
940430449 2:153584036-153584058 GGGCTGTGACAGCTGGGGTAGGG + Intergenic
940578916 2:155550848-155550870 AGGTGGTGTCAGATGGAGATGGG - Intergenic
942403895 2:175632430-175632452 CGGTTGTCACAGCTGTAGATGGG - Intergenic
942742018 2:179192079-179192101 TGGTTGTCACAGCTGGGAAAGGG - Intronic
942975877 2:182016227-182016249 ATGTGGTCACTGCTGGAGAATGG + Intronic
944866445 2:203867040-203867062 AATTTGTGACAGCTGTAGACAGG - Intergenic
945493198 2:210479606-210479628 AGCATGTGGCTGCTGGAGAAGGG - Intronic
945878676 2:215304700-215304722 TGGTTGTCACAACTGGAGTAGGG + Intergenic
946477850 2:220025762-220025784 AAGCGGTGACACCTGGAGAATGG + Intergenic
946488022 2:220119663-220119685 TTGTTGTCACAGCTGGAGACAGG + Intergenic
947317196 2:228873559-228873581 AGGAAGTGACAGAAGGAGAATGG + Intronic
947357970 2:229316528-229316550 AGGTTATGATAGCTAGAGCAGGG + Intergenic
947832695 2:233152993-233153015 AGGCGGTGGCAGCTGGAGATGGG + Intronic
948636453 2:239340879-239340901 AGGGTGTGACTGCTGAAGAGGGG - Intronic
1169526408 20:6431172-6431194 AGCTTCTGAGAGCTGAAGAAAGG - Intergenic
1169632021 20:7644469-7644491 AGGTTGGGGAAGATGGAGAAAGG + Intergenic
1169712713 20:8582471-8582493 ACGTAGTTACAGCTGGAGACTGG - Intronic
1170152500 20:13239999-13240021 AGGTTGTTACAGGAGCAGAAAGG + Intronic
1170742683 20:19071891-19071913 AGGCTGTGCCAGCTGGAAAGAGG - Intergenic
1170997756 20:21380703-21380725 TGGAAGTGACAGCTGGTGAAGGG + Intronic
1172474676 20:35227363-35227385 AGGATGTTCAAGCTGGAGAAGGG + Intronic
1173487858 20:43454925-43454947 TGGTTGTCACAGCTGGAGGAGGG - Intergenic
1173806035 20:45925898-45925920 AGGTCCTGGCAGCTGGGGAAGGG - Intergenic
1174052836 20:47779255-47779277 AGGTTGTCCCAACTGGGGAAGGG - Intronic
1174482875 20:50843614-50843636 AGCTTGTAACAGCTGGACAGTGG + Intronic
1175322311 20:58097704-58097726 AGCCTGTGACAACTGAAGAAGGG + Intergenic
1175441662 20:58996502-58996524 TGGCTGAGACAGCTGGAGCAAGG + Intronic
1175468711 20:59210469-59210491 AGGCTGTGTCAGCTGCAGCAGGG + Intronic
1175480059 20:59304362-59304384 AGGGCGTGACAGCAGGAGAGGGG - Intronic
1176268481 20:64223100-64223122 GGGGTGGGACAGCTGGACAAAGG - Exonic
1179403064 21:41102318-41102340 AGGCTGTGACAGCTGCTGGAAGG + Intergenic
1182415337 22:30217756-30217778 AGGTGGTGCCCTCTGGAGAAAGG - Intergenic
1182462169 22:30490820-30490842 GGGTTGGGACATCTGGATAAAGG - Intronic
1183679416 22:39318916-39318938 AGGTTTTGACCGCTAAAGAAAGG + Intronic
1184207494 22:43014624-43014646 AGGTGTAGACAGCTGCAGAAGGG - Intronic
950093816 3:10316268-10316290 AGGGTGGGACAGCTGGGGAAAGG - Intronic
950697675 3:14716129-14716151 TGGTTGTCACAACTGGAGTAGGG - Intronic
951179924 3:19647569-19647591 AGGTTGTTACAGCAGAAGAAGGG - Intergenic
952404486 3:32993291-32993313 AGGTAGTGTAAGGTGGAGAAGGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953076477 3:39575472-39575494 AGGTTGTGATAGTTGGAAAATGG + Intergenic
953899692 3:46833053-46833075 AGGATGTTGGAGCTGGAGAAGGG + Exonic
954484705 3:50836978-50837000 AGGTGGTCTCAGATGGAGAAGGG - Intronic
955060901 3:55490441-55490463 AAGGTGTGACAGCTGGAAAGTGG - Intergenic
955983473 3:64549754-64549776 TGGTTGTGACAGCTGGGGAAAGG - Intronic
956216190 3:66851907-66851929 AGATTGTGGCAGCTGGAAAATGG + Intergenic
956620473 3:71216875-71216897 TGGTTGTCACACCTGGAGGAGGG + Intronic
956929162 3:74023074-74023096 AGGTTGGAATAGCTAGAGAAGGG - Intergenic
957144734 3:76409519-76409541 TTGTTTTGACAGCTAGAGAATGG - Intronic
958002429 3:87767496-87767518 AGGTTGGGACAGCGGGAGAAGGG - Intergenic
958116122 3:89220020-89220042 TGGTTCTCACAGCTGAAGAAAGG + Intronic
958450566 3:94267775-94267797 TGGTTGTCATAGCTGGAGAAGGG + Intergenic
958914272 3:100031072-100031094 AGAATCTGACAGCTGGACAAAGG - Intronic
959270341 3:104200149-104200171 GGGTTCTAACAGCTGGAAAAGGG + Intergenic
959287716 3:104438111-104438133 TGGTTGTCACAGCTGGAGGTTGG + Intergenic
959827995 3:110823386-110823408 AGGTTTTGAGGGCTGGGGAACGG + Intergenic
963315111 3:143751006-143751028 TGGTTCTGCCAGCTGGAGAGGGG - Intronic
963566116 3:146933119-146933141 AGGTGGGGATAGCTGGATAAGGG - Intergenic
964012315 3:151905457-151905479 TCGTTGTCACAGCTGGAGTAGGG - Intergenic
964450048 3:156803308-156803330 AGATTGTGACAGCATGAGAGAGG - Intergenic
965498977 3:169434017-169434039 ACGTTTTGACACTTGGAGAATGG - Intronic
966822054 3:183932872-183932894 TGGTTATGACAGGTGGGGAATGG + Intronic
967882829 3:194313975-194313997 AGGCTGTCACAGCTGGGGCAGGG - Intergenic
969827625 4:9770276-9770298 AAGTTATGACAGCTGGATCAGGG - Intergenic
970011704 4:11466435-11466457 GGGTTGTCACAACTGGGGAAGGG - Intergenic
973279382 4:48342386-48342408 GGGTTGGGGCAGCTTGAGAAGGG + Intronic
974716798 4:65678366-65678388 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
976857421 4:89621502-89621524 GGGTTGTGCCAGTTGGAGATTGG + Intergenic
978194417 4:105954236-105954258 AGCAAGTGACAGCTGGATAAAGG - Intronic
979123375 4:116932023-116932045 TGGTTGTCACAACTGGAGGATGG - Intergenic
979275960 4:118814403-118814425 AGGCTGTGGCAGCTGCAGATTGG - Intronic
980130736 4:128813195-128813217 AGGTGGAGAAAGGTGGAGAAAGG + Intronic
981389425 4:144171286-144171308 TAGTTGTGAGAACTGGAGAATGG + Intergenic
981818117 4:148854721-148854743 GGGTTCTCACAGCTGGAGGAAGG - Intergenic
982347789 4:154379953-154379975 TGGTTGTCACAACTGGGGAAGGG + Intronic
982984269 4:162185490-162185512 AGGTTCTGTCAGCTGGACCATGG + Intergenic
983045274 4:162979709-162979731 AGGCTGAGGCAGCAGGAGAATGG - Intergenic
985096374 4:186416750-186416772 AGGCTGTGACAGCAGGAGGATGG + Intergenic
985314430 4:188640493-188640515 AGGAAGGGACAGATGGAGAAAGG - Intergenic
985663585 5:1169722-1169744 AGGTGGTGTCTGCTGGAGACTGG + Intergenic
987271488 5:16314227-16314249 TGGTTGTCACAGCTGGGGAGGGG - Intergenic
987321805 5:16777296-16777318 AGGTTGTGACATCTTTAAAAGGG + Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
992895926 5:81245174-81245196 AGGCTTTGACAGCTGGGGCAGGG + Intronic
994102228 5:95906502-95906524 AGGTGAGGACAGCTGGAGAGAGG - Exonic
994808166 5:104478788-104478810 AGGTAGTGTCAGATGGAGATGGG + Intergenic
995083220 5:108078302-108078324 AGGTTGTTAGAGATGGACAAAGG - Intronic
995199952 5:109414528-109414550 AGGTGGTCTCAGATGGAGAAGGG + Intergenic
995752965 5:115472822-115472844 AGGCGATGACAGCTGAAGAAAGG + Intergenic
997981160 5:138467988-138468010 AGTTGGTGACAGCTGAGGAAGGG - Exonic
998974163 5:147625876-147625898 AAATAGTGACAGCTGTAGAATGG + Intronic
999809858 5:155117395-155117417 AATTTATGTCAGCTGGAGAAGGG + Intergenic
1000121809 5:158204719-158204741 TGGTTGTCACAGCTGGAGGTGGG + Intergenic
1001330223 5:170756747-170756769 AAGTTGTCACTGATGGAGAAAGG - Intergenic
1001917005 5:175570116-175570138 AGGTGGTGACTTCAGGAGAAGGG - Intergenic
1001931417 5:175675776-175675798 AGAGTTTGACAGGTGGAGAATGG - Intronic
1002580462 5:180207284-180207306 AGGTTCTCACTGCAGGAGAAAGG + Intronic
1003355822 6:5368915-5368937 AGGTCGTGACCACTGGAGAAAGG - Exonic
1004362208 6:14981185-14981207 AGGTTGTCACAGGTGTAAAAAGG + Intergenic
1005470696 6:26159507-26159529 AGGTTTTCACTGCTGGGGAATGG + Intronic
1007056342 6:38889397-38889419 AGGTGGCGACCTCTGGAGAAGGG + Intronic
1008695545 6:54031975-54031997 AGAGTGTGACAGGAGGAGAATGG + Intronic
1008702326 6:54116005-54116027 AGGTTTTGAGAGTTGGAGCAGGG + Intronic
1009459943 6:63900552-63900574 AGGTTCTGTCAGCTGGGGAGAGG - Intronic
1010517581 6:76791483-76791505 AGCTTATGACAGCTAGAAAAAGG - Intergenic
1010819347 6:80395391-80395413 AGGTGATGTCAGATGGAGAAGGG + Intergenic
1012126252 6:95431917-95431939 AGTTTGTGTCAGATGGGGAAAGG + Intergenic
1012140615 6:95622770-95622792 AGGTTGGGGTAACTGGAGAATGG - Intergenic
1012327664 6:97942982-97943004 AGGCTGAGGCAGCAGGAGAATGG + Intergenic
1013727765 6:113120950-113120972 AAGTTGTGACAGCTGGAATTTGG + Intergenic
1014153394 6:118084794-118084816 AAGTACTGACAGCTGGGGAAAGG - Intronic
1021049841 7:15969565-15969587 AGGTTATGAAAGAAGGAGAAAGG + Intergenic
1023181049 7:37484224-37484246 ATGTGGTGACAGCTGGAGGAAGG + Intergenic
1023912373 7:44565205-44565227 AGGTTGGGGCAGCAGGAGAGTGG - Intergenic
1025949000 7:66128711-66128733 AGGGTGGGATTGCTGGAGAAAGG + Intronic
1027212975 7:76165429-76165451 AGGTTGGGAGGGCTGGGGAAGGG + Intergenic
1027598525 7:80208639-80208661 ATGTGATGACAGGTGGAGAATGG - Intronic
1028009244 7:85619627-85619649 TGTTTGTGGCAGCTGGAGGAAGG + Intergenic
1029023139 7:97386257-97386279 ATGTTGTCACAGCTGAGGAAGGG + Intergenic
1029246044 7:99202388-99202410 AGGTTGGGGTAGATGGAGAAGGG + Intronic
1031082848 7:117275022-117275044 ATCTGGTGACACCTGGAGAAGGG + Intergenic
1031637881 7:124123338-124123360 AGGTGGTGGCAGCTTTAGAAGGG - Intergenic
1031930338 7:127679021-127679043 GGGTTGTGACAGTTGAAGAATGG + Intronic
1032144020 7:129362385-129362407 AGGTTGTGAGATAGGGAGAAGGG + Intronic
1033063991 7:138135205-138135227 AGTTGGTGTCTGCTGGAGAATGG + Intergenic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033979373 7:147145322-147145344 TGGTTGTCACAGCTGGAGAGTGG + Intronic
1034004395 7:147453115-147453137 AGGCTTTGCCAGCAGGAGAAAGG - Intronic
1034880218 7:154757253-154757275 AGGATGTGAGGGATGGAGAAGGG - Intronic
1034904217 7:154929708-154929730 AGGTCTTCACTGCTGGAGAAGGG - Intronic
1035164083 7:156973957-156973979 AGGGTGGGAGAGCTGGAGAACGG + Intergenic
1036652984 8:10657366-10657388 TGGTTGTGTCAGCTGGAGGGGGG + Intronic
1037451674 8:19022073-19022095 ACATTGTGAGAGCAGGAGAAGGG + Intronic
1037473830 8:19237394-19237416 AGGTGGAGGTAGCTGGAGAAAGG + Intergenic
1038204607 8:25453975-25453997 ACGTTGTTAGAGTTGGAGAAAGG - Intronic
1038278609 8:26142596-26142618 TGGTTCTGACATCTGGAGCAAGG + Intergenic
1038324787 8:26564652-26564674 AGGTGGTGACAGCTGCTGAGAGG + Intronic
1039925987 8:41932882-41932904 AGGAAGTCACAGCAGGAGAATGG + Exonic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1043008981 8:74858158-74858180 AGGTGGTGGCAGCTGAAGTAAGG - Intergenic
1043664857 8:82796518-82796540 ACATTGTGAAAACTGGAGAATGG - Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1044329449 8:90899230-90899252 AAGGTGTGGCAGCTGGAGATGGG + Intronic
1045272638 8:100674960-100674982 TGGTTGTCACACCTGGAGGAGGG - Intergenic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1046981026 8:120336557-120336579 ATGTTCTGGCAGCTGGGGAATGG - Intronic
1047801691 8:128316760-128316782 AGGTGATGACAGCAAGAGAATGG + Intergenic
1049317262 8:141975906-141975928 AGCTGGTGGCAGCTGGAGGAAGG + Intergenic
1049415209 8:142491910-142491932 AGGAGGAGACAGCTGGAGCAAGG + Intronic
1050727524 9:8668966-8668988 TTCTTGTGACAGCTGGGGAAGGG - Intronic
1051752792 9:20361206-20361228 AGGTAGGGAGAGCAGGAGAAGGG - Intronic
1052986505 9:34491782-34491804 AGGTTGTGCAAGCTGGAAACAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055432574 9:76258926-76258948 ATGATGTGACAGTTGGACAATGG - Intronic
1055484897 9:76747139-76747161 AGCTGGTGTCTGCTGGAGAAGGG + Intronic
1056550632 9:87650771-87650793 TGGTTGTCACAGCTAGAGATGGG + Intronic
1057546917 9:96026034-96026056 AGGTCCTGGAAGCTGGAGAAGGG + Intergenic
1058197499 9:101996577-101996599 AAGTTGTGACTTCTGGAGAAAGG + Intergenic
1058567721 9:106304360-106304382 AGGTTCTGAGAGCTGGAACAAGG + Intergenic
1058807737 9:108608603-108608625 AGGATGTGATAGTTGGAGGAGGG - Intergenic
1059959073 9:119547555-119547577 AGGTTTTGACAGCATTAGAAGGG - Intergenic
1060389527 9:123267363-123267385 AGGTGGGGACAGTAGGAGAAGGG - Intronic
1061198425 9:129121681-129121703 TAGTTGTGACAGCTGGGGAAAGG - Intronic
1186086195 X:5993218-5993240 GGGTTGTTACAGCTGGAGATTGG - Intronic
1186213839 X:7278653-7278675 ATGTTGTGAGAGCTGCAGAAGGG + Intronic
1186311542 X:8324715-8324737 ATGTAGTCTCAGCTGGAGAATGG + Intergenic
1186371618 X:8952777-8952799 GGGTTGTTACAGCTGGGAAATGG + Intergenic
1187985389 X:24805053-24805075 AGCTTCTGAAAGCTGGAAAAGGG - Intronic
1188002938 X:24999060-24999082 AGGTAGTAAGGGCTGGAGAAAGG - Intergenic
1188489237 X:30720249-30720271 AGGTAATGACAGCTGGAAAAAGG - Intronic
1188829086 X:34874000-34874022 AGGATGTAATAGCAGGAGAATGG + Intergenic
1189130283 X:38491139-38491161 TGGTTGTCACAGCTGGGGAGAGG + Intronic
1189347631 X:40254043-40254065 AGCTAGTGACAGCTGGGGGAAGG - Intergenic
1190363543 X:49671074-49671096 TGGTTGTTACAACTGGGGAAAGG - Intergenic
1191861635 X:65670292-65670314 AGCGTGTGACAGATGGAGAAAGG + Intronic
1198153065 X:133930256-133930278 TGGTTGTCACAACTGGAGAGAGG + Intronic
1200136050 X:153875375-153875397 GGGGTGTGGCAGCAGGAGAATGG - Intronic