ID: 1033516278

View in Genome Browser
Species Human (GRCh38)
Location 7:142109980-142110002
Sequence CTGCAGAAACAGGGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033516271_1033516278 4 Left 1033516271 7:142109953-142109975 CCATAAGGACAGAAAGTAGGTTA No data
Right 1033516278 7:142109980-142110002 CTGCAGAAACAGGGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033516278 Original CRISPR CTGCAGAAACAGGGGGAGAT GGG Intergenic
No off target data available for this crispr