ID: 1033518326

View in Genome Browser
Species Human (GRCh38)
Location 7:142131750-142131772
Sequence CAGGCTAATTTTTATTTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 896
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 842}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033518317_1033518326 16 Left 1033518317 7:142131711-142131733 CCTCTCTCCCTCTCTGCAGGAAT 0: 1
1: 0
2: 3
3: 73
4: 463
Right 1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG 0: 1
1: 0
2: 3
3: 50
4: 842
1033518320_1033518326 8 Left 1033518320 7:142131719-142131741 CCTCTCTGCAGGAATCTCTGGAT 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG 0: 1
1: 0
2: 3
3: 50
4: 842
1033518319_1033518326 9 Left 1033518319 7:142131718-142131740 CCCTCTCTGCAGGAATCTCTGGA 0: 1
1: 1
2: 2
3: 23
4: 284
Right 1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG 0: 1
1: 0
2: 3
3: 50
4: 842

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033518326 Original CRISPR CAGGCTAATTTTTATTTGAT GGG Intronic
900249434 1:1659707-1659729 CCGGCTAATTTTTATATTTTTGG + Intronic
900260371 1:1725018-1725040 CCGGCTAATTTTTATATTTTTGG + Intronic
901062766 1:6480527-6480549 CTGGCTAATTTTTTTTTTTTTGG - Intronic
901694307 1:10995218-10995240 CAAGCTAATTTTTAAATGACTGG - Intergenic
901984446 1:13063165-13063187 CTGGCTAATTTTTATATTTTTGG + Intronic
901997364 1:13163605-13163627 CTGGCTAATTTTTATATTTTTGG - Intergenic
902290267 1:15430708-15430730 CCGGCTAATTTTTATATTTTTGG - Intergenic
902519755 1:17009557-17009579 CAGGCTAATTTTTTTTTAGTAGG + Intronic
902527821 1:17070821-17070843 CAGGCTAATTTTTGTATTTTTGG + Intronic
902574170 1:17366807-17366829 CAGGGAAGTTTTTGTTTGATGGG - Intergenic
903063695 1:20686715-20686737 CTGGCTAATTTTTATATTTTAGG + Intronic
903147293 1:21382721-21382743 CCGGCTAATTTTTGTATGTTTGG - Intergenic
903595836 1:24493807-24493829 CAGGCTAATTTTTTTTTTTTTGG + Intergenic
903645782 1:24895666-24895688 CTGGCTAATTTTTTTTTTAGAGG - Intergenic
903798429 1:25947966-25947988 CTGGCTAATTTTTATATTTTTGG - Intergenic
903917913 1:26777904-26777926 CCGGCTAATTTTTATATTTTTGG - Intronic
904128039 1:28256084-28256106 CCGGCTAATTTTTATGTTTTTGG + Intergenic
904521634 1:31100438-31100460 CCGGCTAATTTTTATTATCTGGG - Intergenic
904576807 1:31510100-31510122 CCGGCTAATTTTTATATTTTTGG + Intergenic
904663882 1:32105249-32105271 CCGGCTAATTTTTTGTTGTTGGG - Intergenic
904694846 1:32323557-32323579 CTGGCTAATTTTTATGTTTTTGG + Intronic
904791583 1:33026357-33026379 CTGGCTAATTTTTATGTAATTGG + Intronic
905969737 1:42132379-42132401 CAGGCTAATTTTTGTGTTTTTGG - Intergenic
906096234 1:43226009-43226031 CTGGCTAATTTTTATATTTTTGG - Intronic
906415545 1:45619075-45619097 CAGGCTAATTTTTGTATTTTTGG + Intergenic
906456726 1:46003634-46003656 CAGGCTAATTTTTTGTAGAGAGG + Intronic
906628057 1:47341915-47341937 CTGGCCAATTTTTATTTTTTGGG + Intronic
907066906 1:51493361-51493383 CTGGCTAATTTTTATTTTTTTGG - Intronic
907443396 1:54491846-54491868 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
907933904 1:59025190-59025212 CAGGCTATTTTTTTTTTTTTGGG - Intergenic
908149487 1:61285252-61285274 CACGCTGGTTTTTAATTGATGGG - Intronic
908217285 1:61966522-61966544 CAGGCTAATTTTTGTATTTTTGG - Intronic
908677697 1:66624050-66624072 CATGCTATTTTTTATCTCATAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909658163 1:78053767-78053789 CTGGCTAATTTTTTTTTTTTTGG - Intronic
909723313 1:78802980-78803002 CATGATAATTTTTATATGACGGG + Intergenic
909835499 1:80249457-80249479 CAGGCTAATTTTTTTATTTTTGG - Intergenic
909847682 1:80416527-80416549 CTGGCTAATTTTTGTTTTTTGGG + Intergenic
909880159 1:80865424-80865446 CAAGCTACTTTTTATTTCTTTGG + Intergenic
910191422 1:84599845-84599867 CTGGCTAATTTTTCTTTTTTGGG - Intergenic
910978352 1:92932277-92932299 CTGGCTAATTTTTGTATGTTTGG - Intronic
911029260 1:93468590-93468612 CTGGCTAATTTTTATATTTTTGG + Intronic
912143232 1:106757432-106757454 CATTCTAATTTTTTTTTGCTTGG - Intergenic
912250502 1:108007477-108007499 CAGGCTATTTTTTATTTTATGGG - Intergenic
913424891 1:118717294-118717316 CATGCCAATTTTTGTTTGTTTGG - Intergenic
914905932 1:151743970-151743992 CTGGCTAATTTTTAAATGTTTGG + Intergenic
914928820 1:151911365-151911387 CTGGCTAATTTTTATATTTTTGG + Intergenic
915126125 1:153666343-153666365 CTGGCTAATTTTTATATTTTTGG + Intronic
915226238 1:154413691-154413713 AATGCTAATTTTATTTTGATTGG + Intronic
915381712 1:155447389-155447411 CTGGCTAATTTTTATATTTTTGG + Intronic
915483892 1:156206692-156206714 CCGGCTAATTTTTATATTTTTGG + Intronic
916024368 1:160820989-160821011 CTGGCTAATTTTTATATTTTTGG - Intronic
916219342 1:162428114-162428136 CCGGCTAATTTTTATATTTTTGG - Intergenic
916353910 1:163883090-163883112 CTGGCTAATTTTTATATTTTTGG + Intergenic
916399653 1:164432958-164432980 CAGGGGGATTTTTATTTGTTGGG - Intergenic
916556034 1:165895250-165895272 CAGGCTAATTTTTGTATTTTTGG - Intronic
916670523 1:167014692-167014714 CAGGCCATTTTTTATTGGAAAGG - Intronic
916675303 1:167060232-167060254 CAGGCTAATTTTTGTATTTTTGG + Intronic
917448384 1:175126261-175126283 CCGGCTAATTTTTGTATGTTTGG + Intronic
917549612 1:176010981-176011003 AAGGCTAATTTTTAATTGTGAGG + Intronic
917552110 1:176042865-176042887 CTGGCTAATTTTTATATTTTTGG - Intronic
917802947 1:178586879-178586901 CTGGCTAATTTTTATCTTTTTGG - Intergenic
918062571 1:181074652-181074674 CCGGCTAATTTTTATATTTTTGG - Intergenic
918081697 1:181212736-181212758 CAGGCAGATTTTTATTACATGGG + Intergenic
918306853 1:183254597-183254619 CTGGCTAATTTTTTTTTGGTGGG + Intronic
919273523 1:195382795-195382817 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
919297031 1:195715480-195715502 TAGGCTCATTTTTATTTTAAGGG + Intergenic
919626421 1:199914821-199914843 CTGGCTAATTTTTATATTTTTGG - Intergenic
919950208 1:202356017-202356039 CTGGCTAATTTTTTTTTGGGTGG - Intronic
920802303 1:209200826-209200848 CTGGCTAATTTTTAATTTTTTGG - Intergenic
921472496 1:215566438-215566460 GAGGCTATTTTTTATTTTTTTGG + Intergenic
921637351 1:217512158-217512180 CTGGCTAATTTTTCTTTTTTTGG - Intronic
922527880 1:226320056-226320078 CTGGCTAATTTTTATATTTTTGG + Intergenic
923250066 1:232171910-232171932 CAGGCTAATTTTTTTATTTTTGG - Intergenic
923305287 1:232682746-232682768 CAGGCTAATTTTTGTATTTTTGG - Intergenic
923507774 1:234620980-234621002 CTGGCTAATTTTTAATTTTTTGG - Intergenic
923555716 1:234999033-234999055 CAGGCTAATTTTTGTATTTTTGG + Intergenic
923593821 1:235344557-235344579 CAGGCCAAAATTAATTTGATAGG - Intergenic
924105188 1:240642500-240642522 CTGGCTAATTTTTAATTTTTTGG + Intergenic
924611060 1:245574303-245574325 CAGGCTAATTTTTGTATTTTTGG + Intronic
1062778798 10:181455-181477 CAGGCTAATTTTTGTATCTTTGG - Intronic
1063736638 10:8763261-8763283 AATGCTAATCTTGATTTGATTGG - Intergenic
1063922938 10:10949637-10949659 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
1063974763 10:11406369-11406391 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1064053832 10:12080903-12080925 CTGGCTAATTTTTTTTTTTTTGG - Intronic
1064118961 10:12603070-12603092 CCGGCTAATTTTTATATTTTTGG + Intronic
1064294629 10:14067312-14067334 CATACTAATTTTTTTTTGAGAGG - Intronic
1064728788 10:18308153-18308175 CAGGCTAATTTTTGTATTTTTGG + Intronic
1064861485 10:19831093-19831115 CTGCATAATTTTCATTTGATAGG + Intronic
1065482132 10:26206220-26206242 CCGGCTAATTTTTATATTTTTGG + Intronic
1065510781 10:26476218-26476240 CTGGCTAATTTTTATATTTTTGG + Intronic
1065847846 10:29761064-29761086 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1066010952 10:31192996-31193018 CAAGCTAATTTTTAATTTTTTGG + Intergenic
1066239807 10:33522597-33522619 CAGGCTAACTTTTATATTTTGGG - Intergenic
1066479685 10:35783433-35783455 CAGACTGATTTTTATTTGCAGGG + Intergenic
1066519688 10:36202091-36202113 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1066546287 10:36503936-36503958 CTGGCTAATTTTTTTTTGGAGGG + Intergenic
1066691573 10:38033872-38033894 CAGGCTAATTTTTGTATTTTTGG + Intronic
1067378353 10:45749271-45749293 CCGGCTAATTTTTATATTTTTGG - Intronic
1067886051 10:50089946-50089968 CCGGCTAATTTTTATATTTTTGG - Intronic
1068076490 10:52262430-52262452 CTGGCTAATTTTTATATTTTTGG + Intronic
1068273566 10:54761519-54761541 CAGGCTAATTTTTGTATTTTGGG - Intronic
1069021476 10:63493210-63493232 CAGGCTATTTTTAAGTAGATGGG + Intergenic
1069476081 10:68733823-68733845 CTGGCTAATTTTTATATTTTTGG + Intronic
1070028721 10:72656598-72656620 CTGGCTAATTTTTGTATGTTTGG - Intergenic
1070330874 10:75416087-75416109 CTGGCTAATTTTTATTTTTTTGG + Intergenic
1070517165 10:77218846-77218868 CCGGCTAATTTTTGTTTTTTGGG + Intronic
1070903644 10:80052719-80052741 CCGGCTAATTTTTATATTTTTGG + Intergenic
1071284321 10:84130174-84130196 CTGGCTAATTTTTATATTTTTGG - Intergenic
1071414084 10:85424697-85424719 CAACATCATTTTTATTTGATTGG - Intergenic
1071710743 10:88046611-88046633 GAGGCTAATATTTATATGATAGG + Intergenic
1071858913 10:89652999-89653021 CATGTTAATTTTTATTACATGGG - Intergenic
1072191307 10:93078912-93078934 CCGGCTAATTTTTATATTTTTGG + Intergenic
1072349600 10:94544383-94544405 CAGGCTAATTTTTGTTGGTTTGG - Intronic
1072350812 10:94555273-94555295 CCGGCTAATTTTTATATTTTTGG - Intronic
1072352401 10:94569568-94569590 TAGGCTAATTTTTATTTTTAGGG + Intronic
1073030352 10:100520579-100520601 CCGGCTAATTTTTATATTTTTGG - Intronic
1073059043 10:100722543-100722565 CTGGCTAATTTTTAGTAGAGGGG - Intergenic
1073211517 10:101806910-101806932 CTGGCTAATTTTTATATTTTTGG - Intronic
1073430758 10:103485311-103485333 CTGGCTAATTTTTGTTTCTTTGG + Intergenic
1073770014 10:106725767-106725789 CAGGCTAATTTTTGTATTTTTGG - Intronic
1074521043 10:114224164-114224186 CAGCCTAATAGTTAATTGATAGG + Intronic
1074995840 10:118756132-118756154 CAGGCTAATTTTGTTTTTAGAGG - Intergenic
1075264948 10:120992109-120992131 CTGGCTATTTTTTATATTATAGG - Intergenic
1075338629 10:121627444-121627466 CAGCCTAATTTATACTTGATAGG + Intergenic
1077629812 11:3803587-3803609 CAGGCTAATTTTTATATTTTTGG + Intronic
1078651689 11:13200550-13200572 CTGGCTAATTTTTAGTAGAGTGG - Intergenic
1079758137 11:24292189-24292211 AAGGCTACTTTTAATTTGATTGG - Intergenic
1080281105 11:30557829-30557851 CAGGCTAATGTTTCTTTGATTGG - Intronic
1080547711 11:33337515-33337537 CCGGCTAATTTTTATATTTTTGG + Intronic
1081045058 11:38263607-38263629 AAGGGGAAGTTTTATTTGATTGG + Intergenic
1081230401 11:40579173-40579195 CAGGCTAATTTTTGTATTTTTGG - Intronic
1081919058 11:46755765-46755787 CAGGCTAATTTTTCTATTTTTGG - Intronic
1081945198 11:46986628-46986650 CTGGCTAATTTTTGTATTATTGG + Intronic
1082051581 11:47774627-47774649 CAGGCAAATTTTTATTATTTTGG - Intergenic
1082183122 11:49144430-49144452 CTGGCTAATTTTTATATTTTTGG - Intergenic
1083102836 11:60327866-60327888 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1083239666 11:61378170-61378192 CTGGCTAATTTTAATTTTTTTGG + Intergenic
1083859687 11:65413292-65413314 CAGGCGAATTCTTCTCTGATGGG + Exonic
1084324752 11:68393617-68393639 CCGGCTAATTTTTATATTTTTGG - Intronic
1084326797 11:68404995-68405017 CAGACTAATTTTTTTTTTTTTGG - Intronic
1084364465 11:68688465-68688487 CTGGCTAATTTTTATATTTTTGG - Intronic
1084643479 11:70440135-70440157 CTGGCTAATTTTTTTTTTTTAGG + Intergenic
1085071716 11:73552793-73552815 CAGGCTAATTTTTGTATTTTTGG - Intronic
1085136857 11:74098409-74098431 CCTGGTAATTTTTATTTGGTAGG - Intronic
1085419939 11:76348035-76348057 CAGGTTTATTTCTGTTTGATAGG - Intergenic
1085675411 11:78513086-78513108 CTGGCTAATTTTTATATTTTTGG - Intronic
1085953560 11:81363352-81363374 CAAGCTACTTTTTATTTCCTGGG + Intergenic
1086107734 11:83164713-83164735 CTGGCTAATTTTTTTTTTTTTGG - Intronic
1086149906 11:83597622-83597644 CTGGCTAATTTTTTTTTTTTGGG - Intronic
1087811430 11:102612896-102612918 CGGGCTAATTTTTATATTTTTGG + Intronic
1087865501 11:103221692-103221714 CAGGCTAATTTTTGTATTTTTGG - Intronic
1088002363 11:104897599-104897621 CCAAATAATTTTTATTTGATAGG + Intergenic
1088979499 11:114849141-114849163 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1089121881 11:116142808-116142830 CAGGCTATTTTATTTTTTATTGG - Intergenic
1089265886 11:117261416-117261438 CTGGCTAATTTTTATATTTTTGG - Intronic
1090009832 11:123036358-123036380 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1090358590 11:126157346-126157368 CTGGCTAATTTTTATATTTTTGG + Intergenic
1090815226 11:130288210-130288232 CCGGCTAATTTTTATATTTTTGG - Intronic
1091054619 11:132406551-132406573 CTGGCTAATTTTTATATTTTTGG + Intergenic
1091102040 11:132883760-132883782 AAGAATAATTTTTATTTTATAGG - Intronic
1091428259 12:410543-410565 CAGGCTAATTTTTGTATTTTTGG + Intronic
1091561885 12:1620863-1620885 CTGGCTAATTTTTCTATTATTGG + Intronic
1092847962 12:12601618-12601640 CCGGCTAATTTTTGTATGTTTGG - Intergenic
1093320629 12:17708940-17708962 CAGACTAATGGTTATTTGATGGG - Intergenic
1093415443 12:18914944-18914966 CTGGCTAATTTTTATATTTTTGG + Intergenic
1093460226 12:19401348-19401370 CAGGCTAATTTTTTTTATTTTGG + Intergenic
1094015426 12:25857532-25857554 CTGGCTAATTTTTATATTTTTGG - Intergenic
1094170130 12:27482460-27482482 CTGGCTAATTTTTATATTTTTGG + Intronic
1094649474 12:32361389-32361411 CTGGCTAATTTTTGTATGTTTGG - Intronic
1095146588 12:38736717-38736739 TAGGCAAATTTTAATTTGAATGG - Intronic
1095753307 12:45734205-45734227 CAGGCTAATTTTTCTATTTTTGG - Intronic
1096055392 12:48646457-48646479 CTGGCTAATTTTTAGTAGAGAGG - Intergenic
1096248634 12:50012127-50012149 CAGCCTAGTTTTTATTTTTTTGG - Intronic
1096309890 12:50511452-50511474 CTGGCTAATTTTTATATTTTTGG + Intronic
1097487641 12:60225695-60225717 CCGGCTAATTTTTATATTTTTGG + Intergenic
1097500994 12:60402008-60402030 CAGGCTAATTTTTGTATTTTGGG - Intergenic
1097993835 12:65865794-65865816 CCGGCTAATTTTTTTTTTTTTGG + Intronic
1098363815 12:69681488-69681510 CAGGCCAAATTTTATTTAAGAGG + Intronic
1098647404 12:72920447-72920469 CAGGCTAATTTTTCTATTTTTGG + Intergenic
1099068206 12:78010970-78010992 CAGAATAATTTATATTAGATAGG - Intronic
1099130033 12:78816903-78816925 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1099994426 12:89762979-89763001 TAGGCTATTATTTATTTGAAAGG - Intergenic
1100117569 12:91326448-91326470 CAGATTAATTCTTATTTGAAGGG + Intergenic
1100449638 12:94693245-94693267 CAGGCAAGATTTTATTTGCTGGG + Intergenic
1100722392 12:97372708-97372730 CTGGCTAATTTTTGTATGTTTGG - Intergenic
1100931426 12:99614271-99614293 CAGGCTAATTTTTGTATTTTTGG - Intronic
1101096513 12:101347359-101347381 CTGGCTAATTTTTATATCTTTGG - Intronic
1101378382 12:104190717-104190739 CTGGCTAATTTTTAAATTATTGG - Intergenic
1101400588 12:104383419-104383441 CTGGCTAATTTTTTTTGGAGGGG + Intergenic
1101595332 12:106159607-106159629 CTGGCTAATTTTTTTTTTAGAGG - Intergenic
1101756348 12:107623526-107623548 CTGGCTAATTTTTATATTTTTGG + Intronic
1101899234 12:108778963-108778985 CTGGCTAATTTTTGTATTATTGG + Intergenic
1102108820 12:110348696-110348718 AAGGCTGATTTTTTTTTGACAGG - Intronic
1102276923 12:111589608-111589630 CTGGCTAATTTTTGTATTATTGG - Intronic
1102278611 12:111600775-111600797 CCGGCTAATTTTTATATTTTTGG - Intergenic
1102547797 12:113669283-113669305 CAGGCTAATTTTTGTATCTTTGG - Intergenic
1102922538 12:116802931-116802953 TAGGCTAATTTTTTTTTTTTTGG - Intronic
1103054681 12:117809300-117809322 CTGGCTAATTCTTTGTTGATGGG + Intronic
1103258641 12:119565169-119565191 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
1103414514 12:120735108-120735130 CTGGCTAATTTTTATATTTTTGG - Intronic
1103426892 12:120843794-120843816 CTGGCTAATTTTTGTATGTTTGG - Intronic
1103564562 12:121809029-121809051 CTGGCTAATTTTTATATTTTTGG + Intronic
1103829035 12:123763723-123763745 CTGGCTAATTTTTATATTTTTGG + Intronic
1104193640 12:126508867-126508889 CTGGCTAATTTTTATATTTTTGG - Intergenic
1104407481 12:128530170-128530192 CAGGCTAACGATGATTTGATGGG + Intronic
1104652970 12:130550368-130550390 CAGGAACATTTTTATTTGAATGG + Intronic
1104740658 12:131170176-131170198 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1106276873 13:28217418-28217440 CTGGCTAATTTTTATATTTTTGG - Intronic
1106319139 13:28622353-28622375 CAGGCCTATTTGTATTTGGTTGG - Intergenic
1106402168 13:29441426-29441448 GAGCCTAATTTCTATTTGTTGGG + Intronic
1107237043 13:38183992-38184014 CAGGGAAATTTTTATTTGCTGGG + Intergenic
1107491472 13:40883691-40883713 CTGGCTAATTTTTATATTTTTGG + Intergenic
1107643805 13:42473403-42473425 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
1107665738 13:42688496-42688518 CCGGCTAATTTTTATATTTTTGG + Intergenic
1107860306 13:44654417-44654439 CTGGCTAATTTTTATATTTTTGG + Intergenic
1108214295 13:48168858-48168880 CTGGCTAATTTTTATATTTTTGG - Intergenic
1108628099 13:52252377-52252399 CAGGTTAATTTTTTTTTTAAAGG + Intergenic
1108657960 13:52554072-52554094 CAGGTTAATTTTTTTTTTAAAGG - Intergenic
1109516546 13:63450413-63450435 CTGGCTAATCTTTATTTTTTTGG + Intergenic
1109532291 13:63665397-63665419 GATGCTAATTTTTAATTTATTGG + Intergenic
1109848516 13:68030229-68030251 CAGGCTCATTTTTATGTTAAAGG + Intergenic
1110645260 13:77876030-77876052 AAGTCTAATTCTTATTTGAATGG + Intergenic
1110956354 13:81557665-81557687 CAGGGAAATTTTTAGGTGATAGG - Intergenic
1111069429 13:83145219-83145241 AAGGCTAATTATTATTGAATTGG - Intergenic
1111181620 13:84675246-84675268 CAGGGTAAATTGTATTTCATTGG - Intergenic
1111279886 13:86008205-86008227 AAGTCAAATTTTTATTTGTTGGG - Intergenic
1112040238 13:95539991-95540013 CAGGCTAATTTTTATATTTTTGG - Intronic
1112131743 13:96532195-96532217 AAGGGGAATTCTTATTTGATGGG + Intronic
1112536497 13:100262229-100262251 CCGGCTAATTTTTATATTTTTGG - Intronic
1112711007 13:102128919-102128941 CAGGCTAATTTTTGTATTTTTGG - Intronic
1113866153 13:113526555-113526577 CTGGCTAATTTTTTTTTTTTTGG - Intronic
1114166163 14:20220543-20220565 CCGGCTAATTTTTTTTTTTTTGG - Intergenic
1114333972 14:21668369-21668391 GAGGAAAATTTTTATTTGCTAGG - Intergenic
1115074255 14:29366273-29366295 CCAGCTAATTTTTATTTTTTTGG - Intergenic
1115252589 14:31365034-31365056 CCGGCTAATTTTTGTATTATTGG + Intronic
1115310313 14:31972987-31973009 CAGTCCAATTTTTCCTTGATAGG + Intergenic
1115649046 14:35390184-35390206 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1115675449 14:35668319-35668341 CAGGCTAATTTTTGTATTTTTGG - Intronic
1116053116 14:39828845-39828867 CAGGCATATTTTTATTTCTTTGG + Intergenic
1116204085 14:41838751-41838773 CAGGCTAAGTTTAATTTTTTTGG - Intronic
1116212116 14:41961793-41961815 CTGGCTAATTTTTGTATGTTTGG - Intergenic
1116361327 14:44001848-44001870 AGGGCTTATTTGTATTTGATAGG - Intergenic
1116409772 14:44607703-44607725 CAGTCTGATTTTTATTAGCTGGG - Intergenic
1116824047 14:49653935-49653957 CTGGCTAATTTTTAAATGAAAGG + Intronic
1116826889 14:49681610-49681632 CAGGCTAATTTTTATATTTTTGG - Intronic
1117321317 14:54626291-54626313 CAGGCTAATCTATATTTTAATGG + Intronic
1117715746 14:58579046-58579068 CTGGCTAATTTTTGTGAGATGGG + Intergenic
1117942537 14:60983327-60983349 CAGGCTAATTTTTGTATTTTGGG - Intronic
1117979595 14:61329395-61329417 CTGGCTAATTTTTATATTTTTGG + Intronic
1118272348 14:64355151-64355173 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1118334259 14:64838969-64838991 CAGGCTAATTTTTGTATTTTTGG - Intronic
1119357215 14:74017722-74017744 CAGGCTAATTTTTGTATTTTTGG - Intronic
1119357394 14:74018825-74018847 CAGGCCAAATGTTTTTTGATAGG - Intronic
1119839281 14:77779207-77779229 CTGGCTAATTTTTGTATTATTGG + Intergenic
1120039565 14:79737322-79737344 CAGCCTAATCTTAATTTTATTGG + Intronic
1120434103 14:84458014-84458036 CAGACAAATATTTATTTGCTTGG + Intergenic
1120753359 14:88218735-88218757 CAGGCTGATTATCACTTGATAGG - Intronic
1121093568 14:91200114-91200136 CTGGCTAATTTTTGTATGTTTGG + Intronic
1121205521 14:92163063-92163085 CTGGCTAATTTTTATATTTTTGG + Exonic
1123167339 14:106338479-106338501 CATGCTAACTTTGATTTTATTGG - Intergenic
1123169958 14:106363188-106363210 CATGCTAACTTTGATTTTATTGG - Intergenic
1123190818 14:106567955-106567977 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1123433188 15:20235577-20235599 CTGGCTAATTTTTGTTTTAGTGG - Intergenic
1123465072 15:20509039-20509061 CCGGCTAATTTTTATATTTTTGG - Intergenic
1123653045 15:22491990-22492012 CCGGCTAATTTTTATATTTTTGG + Intergenic
1123702382 15:22924908-22924930 CTGGCTAATTTTTATATTTTTGG - Intronic
1124009566 15:25826631-25826653 CTGGCTAATTTTTATATTTTTGG - Intronic
1124033189 15:26029862-26029884 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1124035372 15:26049259-26049281 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
1124189555 15:27562904-27562926 ATGGCTAATGTTAATTTGATTGG - Intergenic
1124275798 15:28325018-28325040 CCGGCTAATTTTTATATTTTTGG - Intergenic
1124285679 15:28398563-28398585 CCGGCTAATTTTTTTTTTTTTGG - Intergenic
1124292336 15:28464434-28464456 CCGGCTAATTTTTATATTTTTGG + Intergenic
1124306904 15:28586583-28586605 CCGGCTAATTTTTATATTTTTGG + Intergenic
1124316990 15:28678639-28678661 CTGGCTAATTTTTGTTTGTTTGG - Intergenic
1124566459 15:30818860-30818882 CTGGCTAATTTTTGTTTGTTTGG + Intergenic
1124660742 15:31548972-31548994 CTGGCTAATTTTTATATTTTTGG - Intronic
1125274418 15:37976080-37976102 CTGGCTAATTTTTGTATTATTGG - Intergenic
1125594775 15:40877645-40877667 CTGGCTAATTTTTATATTTTTGG + Intergenic
1125705023 15:41726565-41726587 CTGGCTAATTTTTATATTTTTGG - Intronic
1125717749 15:41828692-41828714 CAGGCTCATGTGTATGTGATGGG + Intronic
1125815863 15:42583615-42583637 CAGCCTAAGTTTTATCAGATAGG + Intronic
1125851766 15:42910880-42910902 CTGGCTAATTTTTATATTTTTGG - Intronic
1125979230 15:43984820-43984842 CTGGCTAATTTTTATATTTTTGG - Intronic
1126780225 15:52133468-52133490 CTGGCTAATTTTCATTTGTAGGG - Exonic
1127078198 15:55348741-55348763 CTGGCTAATTTATATTTACTTGG - Intronic
1127116518 15:55733045-55733067 CCGGCTAATTTTTATATTTTTGG - Intronic
1127176533 15:56364313-56364335 CCGGCTAATTTTTTTTTTTTAGG + Intronic
1128507609 15:68287050-68287072 CTGGCTAATTTTTGTATTATTGG + Intronic
1128567276 15:68709616-68709638 CCGGCTAATTTTTGTTTCTTTGG + Intronic
1129050852 15:72780632-72780654 CCGGCTAATTTTTATATTCTTGG - Intronic
1129067231 15:72915684-72915706 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1129141629 15:73603699-73603721 CAGCCTGATTTATAATTGATAGG - Intronic
1129444242 15:75605460-75605482 CAGGCTAATTTTTGTATTTTTGG + Intronic
1131736738 15:95340709-95340731 CGGGCCAATTTACATTTGATAGG - Intergenic
1132432800 15:101774522-101774544 CCGGCTAATTTTTTTTTTTTTGG + Intergenic
1132521556 16:392430-392452 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1132617601 16:849646-849668 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1132855174 16:2041602-2041624 CCGGCTAATTTTTTTTTTTTTGG + Intronic
1133012004 16:2918441-2918463 CAGGCTTTTTTTTTTTTGAGAGG + Intronic
1133192766 16:4146695-4146717 CCAGCTAATTTTTTTTTGGTGGG + Intergenic
1133263572 16:4569129-4569151 CTGGCTAATTTTTATATTTTTGG + Intronic
1133524207 16:6588489-6588511 CTGGCTAATTTTTGTATGTTTGG - Intronic
1134480072 16:14611700-14611722 CAGGCTAATTTTTGTATTTTCGG + Intronic
1134484616 16:14647517-14647539 CAGGCTAATTTTTGTATTTTTGG - Intronic
1134671599 16:16059832-16059854 CTGGCTAATTTTTTTTTGTGGGG - Intronic
1135035027 16:19069943-19069965 CTGGCTAATTTTTATATTTTTGG + Intronic
1135157951 16:20070513-20070535 CAGTCTAATTTTTAACTGGTTGG - Intronic
1135506479 16:23041475-23041497 CGGGCTAATTTTTTTTGGAGGGG - Intergenic
1135518863 16:23158068-23158090 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1135634971 16:24067803-24067825 CAGGCTAATTTTTGTATTTTTGG - Intronic
1135686981 16:24505738-24505760 CTGGCTAATTTTTATTAGACGGG + Intergenic
1135695461 16:24582476-24582498 CTGGCTAATTTTTGTATTATTGG - Intergenic
1135697938 16:24606673-24606695 CCGGCTAATTTTTATATTTTTGG + Intergenic
1135827611 16:25743481-25743503 CAGCTTACTTTTTGTTTGATGGG + Intronic
1135966533 16:27040225-27040247 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1135986226 16:27186492-27186514 CTGGCTAATTTTTATATTTTTGG - Intergenic
1136168808 16:28475086-28475108 CTGGCTAATTTTTATATTTTTGG - Intergenic
1136615158 16:31393967-31393989 CCGGCTAATTTTTATATTTTTGG - Intronic
1136624395 16:31453154-31453176 CTGGCTAATTTTTATATTTTTGG + Intergenic
1137406088 16:48190523-48190545 CCGGCTAATTTTTATATCTTTGG + Intronic
1138428051 16:56949686-56949708 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1138638645 16:58364589-58364611 CTGGCTAATTTTTATGTTTTTGG + Intronic
1139527750 16:67527260-67527282 CCGGCTAATTTTTATATTTTTGG - Intronic
1139790594 16:69431158-69431180 CTGGCTAGTTTTTATGAGATGGG + Intronic
1139817043 16:69683368-69683390 CAGTCTAATTTTTATATTTTTGG - Intronic
1140046993 16:71446535-71446557 CTGGCTAATTTTTATATTTTTGG + Intergenic
1140103821 16:71940995-71941017 CAGGCTAATTTTTGTATTTTTGG + Intronic
1140164570 16:72536472-72536494 AATGTTAATTTTTATTTGGTTGG + Intergenic
1140294369 16:73694159-73694181 CTGGCTAATTTTTATATTTTTGG - Intergenic
1140452602 16:75082713-75082735 CTGGCTAATTTTTATATTTTTGG + Intronic
1140513524 16:75525752-75525774 CAGGCTAATTTTTGTATTTTGGG - Intergenic
1140960422 16:79906736-79906758 ATGGCTATTTTTTATTTTATTGG - Intergenic
1141580560 16:84995462-84995484 CCGGCTAATTTTTATATTTTTGG - Intronic
1141595017 16:85092102-85092124 CCGGCTAATTTTTATATTTTTGG + Exonic
1141975399 16:87512655-87512677 CTGGCTAATTTTTATATTTTTGG + Intergenic
1141981199 16:87551397-87551419 CTGGCTAATTTTTGTATGTTTGG - Intergenic
1142038304 16:87876271-87876293 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1142408343 16:89903507-89903529 CCGGCTAATTTTTATATTTTTGG - Intronic
1143244862 17:5475582-5475604 CAGGCTAATTTTTGTATTTTTGG - Intronic
1143536723 17:7545333-7545355 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1143607504 17:7997763-7997785 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1143937968 17:10507222-10507244 CTGGCTAATTTTTATATTTTTGG + Intronic
1144104075 17:11970541-11970563 CTGGCTAATTTTTATATTTTTGG + Intergenic
1144441467 17:15286498-15286520 CAGGCTAATTTTTAAATTTTTGG + Intergenic
1144767950 17:17743149-17743171 CCGGCTAATTTTTAATTTTTTGG + Intronic
1146042033 17:29464980-29465002 CTGGCTAATTTTTATATTTTTGG + Intronic
1146044700 17:29494345-29494367 CCAGCTAATTTTTATTTTTTGGG - Intronic
1146112752 17:30105323-30105345 CTGGCTAATTTTTATATTTTTGG - Intronic
1146201946 17:30866357-30866379 CAGGCTAATTTTTGTATTTTTGG + Intronic
1146732963 17:35211713-35211735 CAGGCTAATTTTTTTATTTTTGG + Intergenic
1146861748 17:36307927-36307949 CAGGATGATTTTTATTTGTCAGG + Intronic
1147092076 17:38112031-38112053 CAGGATGATTTTTATTTGTCAGG + Intergenic
1147105133 17:38208468-38208490 CAGGATGATTTTTATTTGTCAGG - Intergenic
1147206432 17:38840844-38840866 CAGACTAATTTTTATATTTTTGG - Intronic
1147313991 17:39610606-39610628 CTGGCTAATTTTTGTTTTTTAGG - Intergenic
1147485468 17:40808442-40808464 CTGGCTAATTTTTATATTTTTGG + Intergenic
1147630294 17:41926004-41926026 CAGGCTAATTTTTGTATTTTTGG + Intronic
1147943130 17:44064569-44064591 CCGGCTAATTTTTTTTTTTTTGG - Intronic
1148371295 17:47101655-47101677 CTGGCCAATTTTCATTTGTTTGG - Intergenic
1148629780 17:49098240-49098262 CTGGCTAATTTTTGTTTTTTTGG + Intergenic
1148702060 17:49594048-49594070 CCGGCTAATTTTTATGTTTTTGG - Intergenic
1149155516 17:53624611-53624633 CAGGATAATTGTTATTTAGTGGG - Intergenic
1149262267 17:54892845-54892867 CCGGCTAATTTTTATATTTTTGG + Intergenic
1150126456 17:62638574-62638596 CTGGCTAATTTTTATATTTTTGG - Intronic
1150175479 17:63050205-63050227 CTGGCTAATTTTTATTTTGGAGG - Intronic
1150374406 17:64668414-64668436 CTGGCTAATTTTTTGTAGATAGG - Intergenic
1150558484 17:66275003-66275025 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1150601142 17:66652118-66652140 CCGGCTAATTTTTGTTTTTTTGG + Intronic
1150782925 17:68137610-68137632 CTGGCTAATTTTTATATTTTTGG + Intergenic
1150841133 17:68606693-68606715 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
1151261333 17:72918245-72918267 CTGGCTAATTTTTATATTTTTGG - Intronic
1151328365 17:73392428-73392450 CCGGCTAATTTTTATATTTTTGG + Intronic
1151362918 17:73599368-73599390 CAGGCTAATTTTTGTATTTTTGG - Intronic
1153649312 18:7225463-7225485 CTGGCTAATTTTTAGTAGAGAGG + Intergenic
1155116229 18:22770558-22770580 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1155126322 18:22879935-22879957 CAGGCTTATTTTTATTTTCCCGG - Intronic
1155305570 18:24474845-24474867 CAGGCTAATTTTTGTATTTTTGG + Intronic
1155334292 18:24748994-24749016 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
1156214641 18:34983789-34983811 CCGGCTAATTTTTATGTTTTTGG + Intronic
1156647035 18:39176513-39176535 TAGGCTTATTTTTATCTTATTGG + Intergenic
1156962503 18:43050186-43050208 CAGGCTAATTTTTAATTTTTTGG + Intronic
1157057680 18:44249979-44250001 CATGCTAATTTTGTTTTGTTTGG + Intergenic
1157902318 18:51531124-51531146 CAGGCAAATTTTTATATTTTTGG + Intergenic
1158095012 18:53760683-53760705 CTGGCTAATTTTTGTTTTTTTGG - Intergenic
1158154107 18:54406131-54406153 CTGGCTAATTTTTATATTTTAGG + Intergenic
1158700133 18:59737953-59737975 CAGGTTAATTTTTATTACATGGG - Intergenic
1158770327 18:60508359-60508381 CAAGATAATTATTATTTAATTGG - Intergenic
1159358192 18:67364187-67364209 CAGTCAAATTTTAATTTAATTGG + Intergenic
1160739310 19:678670-678692 CTGGCTAATTTTTATGTTTTTGG + Intronic
1161673351 19:5627012-5627034 CTGGCTAATTTCTTTTTGGTGGG - Intronic
1161957303 19:7503644-7503666 CCGGCTAATTTTTATATTTTTGG + Intronic
1162541300 19:11297948-11297970 CTGGCTATTTTTTTTTTGTTGGG + Intronic
1162732665 19:12728330-12728352 CTGGCTAATTTTTATCTTTTTGG - Intergenic
1162969967 19:14174695-14174717 CAGGCTAATTTTTGTATTTTTGG + Intronic
1163024402 19:14501828-14501850 CCGGCTAATTTTTTTATGTTTGG - Intergenic
1163411140 19:17155389-17155411 CAGGCTAATTTTGAATTCTTGGG + Intronic
1163616768 19:18333707-18333729 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
1164123920 19:22292853-22292875 CAGAATAATTTATATTTTATTGG + Intronic
1164176137 19:22776728-22776750 CAGAATAATTTTTATTTCTTTGG - Intronic
1164668121 19:30055738-30055760 CTGGCTAATTTTTGTTTTTTGGG + Intergenic
1164874303 19:31672463-31672485 CAGGCTAATTTTTAAATTATTGG - Intergenic
1164978707 19:32595990-32596012 CTGGCTAATTTTTATATCTTTGG - Intergenic
1164996435 19:32722839-32722861 CCGGCTAATTTTTATATTTTTGG + Intronic
1165145260 19:33726397-33726419 CATGCTAATTTTTGTATTATGGG - Intronic
1165189782 19:34053090-34053112 CTGGCTAATTTTTATATTTTTGG + Intergenic
1165238489 19:34443601-34443623 CTGGCTAATTTTTATATTTTTGG + Intronic
1166065832 19:40358411-40358433 CAGGCTAATTTTTGTATTTTTGG + Intronic
1166068344 19:40373413-40373435 CAGGCTAATTTTTGTATTTTTGG - Intronic
1166131235 19:40746966-40746988 CCGGCTAATTTTTATATTTTTGG + Intronic
1166541959 19:43611479-43611501 CTGGCTAATTTTTATATTTTTGG + Intronic
1166666920 19:44685695-44685717 CTGGCTAATTTTTCTATGTTTGG - Intergenic
1167687653 19:50966637-50966659 CTGGCTAATTTTTGTATGTTTGG - Intronic
1167898379 19:52600363-52600385 CCGGCTAATTTTTGTATAATTGG - Intronic
1168093586 19:54101692-54101714 CCGGCTAATTTTTCTTTTTTAGG - Intronic
1168617991 19:57853915-57853937 CAGGCTAATTTTTGTATTTTCGG + Intronic
925537402 2:4932380-4932402 CAGTCTAATTTTATTTTAATGGG + Intergenic
925972617 2:9117220-9117242 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
926348047 2:11967412-11967434 CTGGCTAATTTTTATATTTTTGG + Intergenic
927023085 2:19038085-19038107 GAGGCAAATTTTTATTAGAGTGG - Intergenic
927803115 2:26119681-26119703 CTGGCTAATTTTTATTTTTGTGG + Intronic
927920054 2:26965345-26965367 CCGGCTAATTTTTATATTTTTGG - Intergenic
927953939 2:27194610-27194632 CAGGCTAATTTTTGTATTTTTGG - Intergenic
928113717 2:28530018-28530040 CTGGCTAATTTTTATATTTTTGG + Intronic
928643145 2:33321420-33321442 CAGGCTAATTTTGTATTCATTGG + Intronic
928668581 2:33576937-33576959 CAGCCTATTTTGTTTTTGATGGG + Intergenic
928999796 2:37335261-37335283 CCGGCTAATTTTTATATTTTTGG + Intergenic
929139136 2:38651906-38651928 CAGGCTAATTTTTGTATTTTTGG - Intergenic
929139187 2:38652223-38652245 CAGGCTAATTTTTGTATTTTTGG - Intergenic
929692441 2:44086116-44086138 CCGGCTAATTTTTGTATGTTTGG - Intergenic
929697137 2:44127808-44127830 CAGGCTAATTTTTTGTAGACAGG - Intergenic
929923439 2:46190124-46190146 CAAGCTAATTGATATTAGATTGG - Intergenic
930808744 2:55519266-55519288 CAGGCTAATTTTTGTATTTTTGG + Intergenic
930811898 2:55551190-55551212 CAGGCTAATTTTTGTATTTTTGG - Intronic
931425803 2:62169957-62169979 CAGGCTAAACTTATTTTGATTGG - Intergenic
931526892 2:63166359-63166381 CTGGCTAATTTTTAATTTGTTGG + Intronic
932044311 2:68332085-68332107 CAAGCTAATTTTTGTATTATCGG + Intergenic
932715523 2:74098753-74098775 CAGGCTAATTTTTATATTTTTGG + Intronic
932899221 2:75678855-75678877 CCAGCTAATTTTTATTTTTTTGG + Intronic
933020028 2:77178422-77178444 CTGGCTAATTTTTGTTTTTTCGG - Intronic
933309230 2:80639369-80639391 CAGGCTAATTTTTGTATTTTTGG + Intronic
933331542 2:80898387-80898409 CAAGTTATTTTTTATCTGATGGG - Intergenic
933629314 2:84638066-84638088 CTGGCTAATTTTTATATTTTTGG - Intronic
933756632 2:85644591-85644613 CTGGCTAATTTTTTTTTTGTAGG + Intronic
935338685 2:102040439-102040461 CAAGCTAATTTTTATATTTTTGG + Intergenic
935422301 2:102881820-102881842 CAGGCAAATTTTTGCTCGATTGG - Intergenic
935971163 2:108532306-108532328 CTGGCTAATTTATTGTTGATAGG - Intergenic
936107394 2:109636774-109636796 CTGGCTAATTTTTATATTTTTGG - Intergenic
936523089 2:113224383-113224405 CTGGCTAATTTTTATATTTTTGG - Intronic
936572023 2:113625479-113625501 CAGGCTGTTTTTTGTTTGTTAGG - Intergenic
936675501 2:114709285-114709307 CAGGTTCATTTTGATTTCATTGG + Intronic
937366520 2:121266025-121266047 CTGGCTAATTTTTATATTTTTGG + Intronic
937629497 2:124084426-124084448 CAGGCTAATTTTTGTATTTTCGG + Intronic
937694625 2:124794743-124794765 CATGATCATTTTTATTTCATCGG + Intronic
938153043 2:128902965-128902987 CCGGCTAATTTTTATATTATTGG - Intergenic
938255093 2:129851795-129851817 CAAGCTAATTTTTGTGTTATTGG - Intergenic
938829838 2:135039418-135039440 CCGGCTAATTTTTTTTTTTTTGG - Intronic
941032593 2:160529489-160529511 CTGGCTGATTTTTTTTTGTTTGG - Intergenic
941166819 2:162091755-162091777 CTGGCTAATTTAGATTTAATAGG - Intergenic
941215152 2:162697536-162697558 CAGGGTAATTGTTATTTTGTGGG + Intronic
941753440 2:169159185-169159207 CAGGAGACTTTTTATTTGAGAGG - Intronic
941832257 2:169975007-169975029 CAGGCTAATTTTTGTATTTTGGG - Intronic
941986807 2:171518575-171518597 CTGGCTAATTTTTGTATGTTTGG - Intergenic
942055327 2:172176981-172177003 CTGGCTAATTTTTATATTTTTGG + Intergenic
942556065 2:177173497-177173519 CAGGCTAATTTTTGTATTTTTGG - Intergenic
942657531 2:178229666-178229688 TTGGCTAATTTTTATGTGTTCGG - Intronic
943029156 2:182666444-182666466 CCGGCTAATTTTGTATTGATGGG - Intergenic
944697087 2:202211805-202211827 CAGGCTAATTTTTGTATTTTTGG - Intronic
944810673 2:203324726-203324748 CAGGCTAATTTTTGTATTTTTGG - Intergenic
945167533 2:206961936-206961958 GAGGCTAATTTTTTTTTTTTTGG - Intronic
945300276 2:208209488-208209510 CAGGCTAATTTTTGTATTTTTGG + Intergenic
946015446 2:216600519-216600541 CAGGCTAATTTTTGTATTTTTGG - Intergenic
946470493 2:219955949-219955971 CAGGCTAATTTTTGTATTTTTGG + Intergenic
946686631 2:222277770-222277792 CAGGCTAATTTTTCTATTTTTGG - Intronic
946796715 2:223362189-223362211 CAGGGCTATTTTTATTTGGTGGG + Intergenic
946912824 2:224484026-224484048 CAGGCTATTTTTTAAATGTTTGG - Intronic
947065842 2:226224846-226224868 CTGGCTAATTTTTGTTTTTTTGG - Intergenic
947541464 2:230982723-230982745 CTGGCTAATTTTTGTTTTTTTGG - Intergenic
947974253 2:234351160-234351182 CTGGCTAATTTTTATATTTTTGG + Intergenic
948169862 2:235892319-235892341 CAGGTTAATTTCTATCTGAGTGG + Intronic
948170406 2:235897199-235897221 CCGGCTAATTTTTATATTGTTGG + Intronic
948300785 2:236905383-236905405 CCGGCTAATTTTTATATTTTTGG - Intergenic
1168915836 20:1486232-1486254 CCGGCTAATTTTTATATTTTTGG + Intronic
1169153711 20:3311300-3311322 CTGGCTAATTTTTTTTTTTTGGG + Intronic
1169441025 20:5634006-5634028 CTGGCTAATTTTTGTATTATTGG - Intergenic
1169663889 20:8012321-8012343 CAGGCACATATTTATTTAATAGG + Intronic
1170616394 20:17955955-17955977 CCGGCTAATTTTTATATTTTTGG + Intronic
1170629346 20:18055013-18055035 CAGGGGAATTTTTATTTACTGGG - Intronic
1172318233 20:33973574-33973596 CTGGCTAATTTTTATATTTTTGG + Intergenic
1172323026 20:34011902-34011924 CCGGCTAATTTTTATATTTTTGG - Intronic
1172452464 20:35036782-35036804 CTGGCTAATTTTTGTATTATTGG - Intronic
1172712501 20:36936820-36936842 CTGGCTAATTTTTCTTTTTTTGG + Intronic
1173117616 20:40260731-40260753 CTGGCTAATTTTTATATTTTTGG + Intergenic
1173121705 20:40296718-40296740 TTGTCTAATTTTTATTTCATTGG - Intergenic
1173489048 20:43464649-43464671 CTGGCTAATTTTTATATTTTTGG - Intergenic
1174010110 20:47442780-47442802 CTGGCTAATTTTTATATTGTTGG - Intergenic
1174320368 20:49737033-49737055 CTGGCTAATTTTTGTTTTTTTGG + Intergenic
1174341610 20:49900623-49900645 CCAGCTAATTTTTTTTTAATGGG + Intergenic
1174369405 20:50076424-50076446 CCGGCTAATTTTTATATTTTTGG + Intergenic
1174488825 20:50877896-50877918 CAGGCTAATTTTTGTATTTTTGG - Intronic
1174722160 20:52824418-52824440 CCGGCTAATTTTTGTATTATTGG - Intergenic
1176893795 21:14351511-14351533 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1176967460 21:15227537-15227559 CTGGCTAATTTTTGTTTTTTGGG + Intergenic
1177419826 21:20841982-20842004 AATTCTCATTTTTATTTGATGGG + Intergenic
1177426804 21:20934102-20934124 CAGGCAACCTTTTATTTGATTGG + Intergenic
1177428170 21:20953161-20953183 CTGGCTAAGTTTTATATTATTGG - Intergenic
1177637260 21:23803509-23803531 CCGGCTAATTTTTATATTTTCGG - Intergenic
1178293275 21:31387382-31387404 CCGGCTAATTTTTATATCATGGG + Intronic
1178319105 21:31591404-31591426 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1178445579 21:32638533-32638555 CCGGCTAATTTTTATATTTTTGG - Intronic
1178543505 21:33475086-33475108 CCGGCTAATTTTTATATTTTTGG + Intronic
1178912875 21:36690292-36690314 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1179201437 21:39226148-39226170 CAGGCTCCTTTTTATTTAAAGGG - Intronic
1179395400 21:41035425-41035447 CAGGCTGATTTTTCTGTTATAGG - Intergenic
1179648952 21:42794254-42794276 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1180241772 21:46512505-46512527 CAGGCTAATTTGCATTTGCCTGG + Intronic
1181010741 22:20039093-20039115 CCGGCTAATTTTTTTTTTTTTGG + Intronic
1181017427 22:20079396-20079418 CCGGCTAATTTTTATATTTTTGG - Intergenic
1181833161 22:25579306-25579328 CTGGCTAATTTTTTTTTTTTTGG + Intronic
1182188845 22:28437752-28437774 CTGGCTAATTTTTGTTTTTTTGG + Intronic
1182288643 22:29262866-29262888 CTGGCTAATTTTTGTTTTTTGGG + Intronic
1182288669 22:29263035-29263057 CTGGCTAATTTTTGTTTTTTGGG + Intronic
1182446847 22:30394709-30394731 CTGGCTAATTTTTTTTTTTTTGG + Intronic
1182594900 22:31411689-31411711 CTGGCTAATTTTTTTTTTTTTGG + Intronic
1183236517 22:36622795-36622817 CAAGCTAATTTTTGTATTATTGG - Intronic
1184619997 22:45670038-45670060 CTGGCTAATTTTTAGTAGAAAGG + Intergenic
1185162279 22:49237132-49237154 CAGGTATATTTTTATCTGATAGG + Intergenic
949534614 3:4986425-4986447 CAGGGTAAGTTTGATTTGTTGGG - Intergenic
949808442 3:7979915-7979937 CTGGCTAATTTTTATATTTTTGG - Intergenic
950035419 3:9881696-9881718 CAGGCTAAATTTTAATTCCTGGG - Intergenic
950233248 3:11294948-11294970 CCGGCTAATTTTTGTTTTTTAGG - Intronic
950621045 3:14205612-14205634 CCGGCTAATTTTTGTTTTTTGGG + Intergenic
951363906 3:21757302-21757324 CAGGCTAATTTTTGTATTTTTGG + Intronic
951999047 3:28763922-28763944 CAGTCTAATTATAATTTTATGGG - Intergenic
952138787 3:30455195-30455217 CAGGCTAATTTTTCTATTTTTGG + Intergenic
952799853 3:37279743-37279765 CAGACTAATTTTTATATTTTCGG - Intronic
953010087 3:39016762-39016784 CAGGCTAATTTTTGTATTTTTGG + Intergenic
953113580 3:39968332-39968354 CAGACTAATTTTTAAGAGATGGG + Intronic
953281052 3:41557602-41557624 CTGGCTAATTTTTTTTTTTTTGG - Intronic
954065367 3:48101658-48101680 CTGGCTAATTTTTCTTTTTTTGG - Intergenic
954474808 3:50734335-50734357 CTGGCTAATTTTTATTTTTTTGG - Intronic
956110707 3:65867571-65867593 CTGGCTAATTTTTAATTATTTGG - Intronic
956645487 3:71451594-71451616 CAGGTTAAATTGTATTTAATTGG - Intronic
956650576 3:71501028-71501050 CTGGCTAATTTTTATATTTTTGG - Intronic
956951268 3:74286065-74286087 TATGCTAATTTGGATTTGATAGG + Intronic
957652639 3:83028868-83028890 CAGGCTTTTTTTCAGTTGATAGG - Intergenic
957975283 3:87435330-87435352 CAGCCATTTTTTTATTTGATGGG - Intergenic
958839837 3:99190804-99190826 CACCCTATTTTTTATTTTATTGG - Intergenic
958938794 3:100287273-100287295 CAGGCTAATTTTTGTATTTTTGG + Intronic
958949757 3:100403623-100403645 CAGGCTAATTTTTTGTATATTGG + Intronic
959289569 3:104456716-104456738 CAGGGTAATTTATATTTGCCAGG + Intergenic
959290954 3:104473626-104473648 TAGGGTAATTTTTTTTTGTTGGG - Intergenic
959639691 3:108618897-108618919 CTGGCTAATTTTTATATTTTTGG - Intronic
960438321 3:117655002-117655024 AAGGCCAAATTTTATTTGCTAGG - Intergenic
961192430 3:124973181-124973203 CAGGCTAATTTTTTGTAGAGAGG + Intronic
961854323 3:129854228-129854250 CAGGCTAATTTTTGTATTTTGGG - Intronic
962557385 3:136568193-136568215 CAGGTTAATTTGTATTACATGGG - Intronic
963004636 3:140715035-140715057 CAGGCTGCTTTTCATTTGAAAGG - Intergenic
963028134 3:140940620-140940642 CAGTCTACTTTTGATTTGACTGG - Intergenic
963187502 3:142435594-142435616 CAGGCTAATTTTTGTATTTTTGG - Intronic
963584606 3:147169652-147169674 CAGGCTAATTTTTTTTTTTCTGG - Intergenic
963766538 3:149342309-149342331 CAGTAGAATTCTTATTTGATAGG - Intergenic
964064380 3:152561520-152561542 CAGGCAGTTTTGTATTTGATGGG + Intergenic
964164702 3:153688851-153688873 CATTCTATTTTTTATTTGAAGGG - Intergenic
964365424 3:155945696-155945718 CAGGCTAATTTTTGTATTTTTGG + Intergenic
964964218 3:162470712-162470734 CTGGCTAATTTTTGTGTGTTTGG + Intergenic
965144482 3:164883187-164883209 CTGGCTTATTTTTATCTTATGGG - Intergenic
965667374 3:171109866-171109888 GAGGCTAATTTTTACTTAATAGG + Intronic
965681169 3:171253120-171253142 CCGGCTAATTTTTTTTTTTTTGG - Intronic
966006316 3:175017570-175017592 CAGGCCTGTTTTTATGTGATTGG + Intronic
966078965 3:175976813-175976835 CAGGTTAATATATTTTTGATTGG - Intergenic
966563982 3:181355492-181355514 CAAGCTAATTTTTATATTTTTGG + Intergenic
966652501 3:182316378-182316400 CAGAATGATTTTTATTTCATTGG + Intergenic
966883869 3:184363887-184363909 CAGGCTAATTTTTGTATTTTTGG - Intronic
966947536 3:184787722-184787744 CCGGCTAATTTTTATATTTTTGG + Intergenic
966957845 3:184902312-184902334 CCGGCTAATTTTTATATTTTTGG - Intronic
967042518 3:185706647-185706669 CATGCTAATTTCTTTTTAATGGG - Intronic
967160130 3:186728811-186728833 CAGGCTAATTTTTGTATTTTGGG + Intronic
967286445 3:187875457-187875479 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
967739076 3:192985514-192985536 CAGGCTAATTTTTGTATTTTTGG + Intergenic
967918883 3:194599744-194599766 CTGGCTAATTTTTGTTTCTTGGG + Intronic
968163046 3:196442842-196442864 CAGGCTAATTTTTGTATTTTTGG - Intergenic
968596203 4:1487109-1487131 CCGGCTAATTTTTGTTTTTTTGG + Intergenic
969473596 4:7406364-7406386 TAGGCTTTTTTTTTTTTGATAGG + Intronic
970226701 4:13866247-13866269 CCAGCTAATTTTTATTTATTTGG + Intergenic
971214699 4:24652263-24652285 CAGGCTAATTTTTGTATCTTTGG - Intergenic
971905803 4:32723944-32723966 GAGGCTAATTTTTCTTTTCTTGG - Intergenic
972751377 4:41992174-41992196 CAGGCTAATTTTTTGTAGAGAGG - Intronic
972804841 4:42518725-42518747 CAATCTATTTTTTATGTGATTGG - Intronic
972943468 4:44225241-44225263 CATGGCAATTTCTATTTGATTGG + Intronic
973987613 4:56370199-56370221 CAGGCTAATTTTTGTATTTTTGG - Intronic
974265005 4:59575086-59575108 CAGTCTAATATTTATTTCTTTGG + Intergenic
974625591 4:64423908-64423930 CATATTAATTTTTATTGGATTGG + Intergenic
974802460 4:66835732-66835754 CAATATAATTTTTATTTAATTGG - Intergenic
975019468 4:69468678-69468700 CAGGCTAATTTTTGTATTTTTGG + Intergenic
975233313 4:71960506-71960528 CAGTCTAATTTTTTTTTAAGAGG - Intergenic
975711292 4:77162542-77162564 CAGGCTAATTTTTATATTTTTGG + Intronic
975854650 4:78611086-78611108 CAGGCTAATTTTTGTATTTTTGG - Intergenic
976168541 4:82280537-82280559 CTGGCTAATTTTTATATTTTTGG - Intergenic
976445331 4:85124591-85124613 CAGCCCACTTTTTTTTTGATGGG + Intergenic
976588601 4:86826415-86826437 CAGGCTAATTTTTGTATTTTTGG - Intronic
976653579 4:87462690-87462712 CAGGCTTATTTTTGTCTTATAGG - Intergenic
976945897 4:90767673-90767695 CAGGGTAATTTTTTTTTAAAGGG + Intronic
978447385 4:108792652-108792674 CTGGCTAATTTTTACATTATTGG + Intergenic
978813901 4:112881274-112881296 CTGGCTAATTTTTATATTTTTGG - Intronic
979488390 4:121295336-121295358 CAGGCTAATTTTTGTATTTTTGG - Intergenic
979677061 4:123420988-123421010 CCGGCTAATTTTTATATTTTTGG + Intergenic
980637115 4:135520824-135520846 CAGGCTAATTTATACATGAAAGG - Intergenic
982718813 4:158838380-158838402 CTGGCTAATTTTTATATTTTTGG + Intronic
982976801 4:162073682-162073704 CAGGGTAATATTTAATTGGTAGG + Intronic
984074477 4:175157734-175157756 CAGGCTAATTTTTGTATTTTTGG - Intergenic
984365953 4:178800479-178800501 CAGGTATATTTTTATTTGATGGG + Intergenic
984654087 4:182298809-182298831 CCGGCTAATTTTTATATTTTTGG - Intronic
985207265 4:187552310-187552332 CCGGCTAATTTTTATATTTTTGG + Intergenic
985390755 4:189490269-189490291 CTGGCTAATTTTTATATTTTTGG + Intergenic
986810015 5:11346794-11346816 CATGCTAATTATCATTTGACTGG - Intronic
986994563 5:13592323-13592345 CAGGCTAATTTTTGTATTTTTGG + Intergenic
987109378 5:14670842-14670864 CAGGATTATTTTTATTTTAATGG + Intronic
987177689 5:15333244-15333266 CAGGCTTTTTTTTCTTTGGTAGG - Intergenic
987686701 5:21213862-21213884 CAGGCTAATTTTTCTATTTTTGG - Intergenic
987802133 5:22712825-22712847 CAGTATATTTTTTATTTGTTGGG - Intronic
987844890 5:23270656-23270678 CAGGCTAATTTTTGTATTTTTGG - Intergenic
988461922 5:31446876-31446898 CTGGCTAATTTTTATATTTTTGG - Intronic
988535597 5:32065136-32065158 CTGGCTAATTTTTGTATTATTGG - Intronic
989018208 5:36966363-36966385 AAAGCTAATTTCTACTTGATAGG - Intronic
990186384 5:53214498-53214520 CAGGCTAATTTTTGTATTTTTGG + Intergenic
990561913 5:56991934-56991956 CTGGCTAATTTTTTTTTTTTTGG + Intergenic
991056073 5:62322079-62322101 CTGGCTAATTTTTTTTAGAGGGG + Intronic
991299196 5:65112521-65112543 CAGGCTAATTTTTGTATTTTTGG - Intergenic
991406278 5:66303733-66303755 CCGGCTAATTTTTGTATGTTTGG + Intergenic
991735645 5:69629565-69629587 CAGGCTAATTTTTTTTTTCTGGG + Intergenic
991770283 5:70034576-70034598 CAGGCTGATTTTTATATTTTTGG + Intronic
991812136 5:70485204-70485226 CAGGCTAATTTTTTTTTTCTGGG + Intergenic
991849578 5:70909995-70910017 CAGGCTGATTTTTATATTTTTGG + Intronic
992323692 5:75639356-75639378 CAGGCTAATTTTTGTATATTTGG + Intronic
992558379 5:77926058-77926080 CAAGCTAATTTTTATATTTTTGG - Intergenic
992571044 5:78057963-78057985 CTGGCTAATTCTTTTTTGTTTGG - Intronic
993516765 5:88846227-88846249 CAGGCTAATTTTTGTATTTTTGG + Intronic
995067652 5:107880227-107880249 CTGGCTAATTTTTTTTTGTTGGG + Intronic
995201894 5:109434497-109434519 CAGGCTAATTTTTGTATTTTTGG - Intergenic
995820508 5:116225004-116225026 TAGGCTAATCTTTAGTTTATGGG + Intronic
996209345 5:120786245-120786267 CAGGGTAATTTTTATTTTTATGG - Intergenic
996346055 5:122489741-122489763 CAGGCTAATTTTTGTATTTTTGG - Intergenic
996707251 5:126509986-126510008 CTGGCTAATTTTTATGTTCTGGG + Intergenic
997556589 5:134804598-134804620 CAGGCTAATTTTTTGTAGAGAGG + Intronic
997902370 5:137778557-137778579 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
998125709 5:139619699-139619721 CAGGCTAATTTTTGTATTTTTGG - Intronic
998264116 5:140654214-140654236 CAGGCCAAATTTTATTTCCTTGG + Intronic
998430051 5:142062911-142062933 CTGGCTAATTTTTATATTTTTGG - Intergenic
998502588 5:142646353-142646375 CCAGCTAATTTTTTTTTGAGAGG + Intronic
998880800 5:146642893-146642915 CTGGCTAATTTTTGTATGTTTGG - Intronic
998967467 5:147555927-147555949 CCGGCTAATTTTTGTATTATTGG - Intergenic
999012738 5:148060214-148060236 CCGGCTAATTTTTATGTTTTCGG + Intronic
999738853 5:154534028-154534050 CAGCCTAATTTTTATTTTTTAGG + Intergenic
999797307 5:155000793-155000815 CTGGCTATTTTTTATTTTTTAGG + Intergenic
999803783 5:155062819-155062841 CTGGCTAATTTTTATATTTTTGG + Intergenic
999866810 5:155709468-155709490 CTGACTATTCTTTATTTGATGGG + Intergenic
1000136488 5:158357484-158357506 CCGGCTAATTTTTTTTTTTTTGG + Intergenic
1000365509 5:160486955-160486977 AAGGCTCATTTTTATTTCAGGGG + Intergenic
1000590716 5:163154190-163154212 CCGGCTAATTTTTATATTTTTGG + Intergenic
1000726275 5:164774968-164774990 AAGACAAATTTTTATTTGAGAGG - Intergenic
1000816904 5:165934306-165934328 CTGGCTAATTTTTATATTTTTGG - Intergenic
1002609798 5:180408950-180408972 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1003026549 6:2559917-2559939 CAGGGAAATTTTAATTTGAATGG - Intergenic
1003333963 6:5153251-5153273 CTGGCTAATTTTTATATTTTAGG + Intronic
1003406523 6:5831113-5831135 CTGGCTAATTTTTATATTTTTGG - Intergenic
1003626246 6:7744312-7744334 CAGGCTAATTTTTGTATTTTTGG - Intronic
1003630164 6:7779499-7779521 CAGGCTAATTTTTATATATTTGG + Intronic
1003901805 6:10661478-10661500 CAGGCTAATTTTTGTATATTTGG - Intergenic
1004393513 6:15228666-15228688 CAGCCTAGTTTTGATTTGCTAGG - Intergenic
1004434655 6:15578692-15578714 CAAGCTAATATTTATTTCTTAGG + Intronic
1004467533 6:15899783-15899805 CTGGCAAATTTTTGTTTGCTCGG - Intergenic
1004643214 6:17535434-17535456 CAGGCTAATTTTTGTATTTTTGG + Intronic
1005070225 6:21855411-21855433 CTGGCTAATTTTTATTTTTTTGG - Intergenic
1005171892 6:22996297-22996319 CTGGCTAAGGTTTATTTCATTGG - Intergenic
1005314618 6:24592807-24592829 CCGGCTAATTTTTATGTTTTTGG - Intronic
1005349778 6:24922696-24922718 CAGGCTAATTTTTGTATTTTTGG - Intronic
1006118191 6:31786503-31786525 CTGGCTAATTTTTATATTTTTGG - Intronic
1006132217 6:31876575-31876597 CAGGCTAATTTCTTTGAGATGGG - Intronic
1006486639 6:34348318-34348340 CTGGCTATTTTTTTTTTGGTGGG - Intronic
1006877129 6:37307515-37307537 CCGGCTAATTTTTATATTTTTGG + Intronic
1006954551 6:37856154-37856176 CTGGCTAATTTTTATATTTTTGG + Intronic
1007750803 6:44070108-44070130 CAGGCTAATTTTTTGTAGAGAGG + Intergenic
1008338170 6:50331971-50331993 AAGGCTATTTTTTATTGAATAGG + Intergenic
1008592498 6:53008585-53008607 CTGGCTAATTTTTATATTTTAGG + Intronic
1008643204 6:53485806-53485828 CCAGCTAATTTTTATTTTTTTGG + Intergenic
1009427296 6:63528383-63528405 CAGGCTGATTTCTAATTGCTGGG - Intronic
1009639958 6:66321745-66321767 CAGTGTAATTTATATTTAATAGG - Intergenic
1010195950 6:73240511-73240533 CAGGCTAATTTTTGTATTCTTGG + Intronic
1011434106 6:87319126-87319148 CAGGAGATTTTGTATTTGATGGG - Intronic
1011454721 6:87536018-87536040 CAGGCTAATCCATATTTTATTGG + Intronic
1011574591 6:88781948-88781970 CAGGATCAGTTGTATTTGATAGG - Intronic
1011810792 6:91129908-91129930 CAGGCTTACGGTTATTTGATTGG + Intergenic
1011933681 6:92746379-92746401 CCTGCAATTTTTTATTTGATAGG + Intergenic
1012196527 6:96348434-96348456 CAGATTTATTTTTATTTCATAGG + Intergenic
1012537444 6:100315879-100315901 CAGCATAATATTTATTTCATGGG - Intergenic
1013209880 6:107977221-107977243 CTGGCTAATTTTTATATTTTTGG - Intergenic
1013982260 6:116145699-116145721 CAAACTATTTTTTATTTTATAGG - Intronic
1014372971 6:120636325-120636347 CAGTCTAAATTTTAATTTATTGG - Intergenic
1015000781 6:128212081-128212103 TAGACTATTTTTTATTTGTTAGG + Intronic
1015316723 6:131824896-131824918 CAGGCTAATTTTTGTATTTTTGG - Intronic
1015839410 6:137460733-137460755 CAGGCTAATTTTTATATTTTTGG - Intergenic
1015839435 6:137460868-137460890 CAGGCTAATTTTTATATTTTTGG - Intergenic
1016723010 6:147324432-147324454 CAGGCTAATTTTTGTATTTTTGG + Intronic
1016952964 6:149599024-149599046 CAGGCTTATTTTTATATTTTTGG + Intronic
1017360715 6:153566197-153566219 CTGGCTAATTTTTATATTCTTGG + Intergenic
1017480824 6:154852753-154852775 CAGTTTAAATTTTATTTGGTAGG - Intronic
1017513088 6:155131196-155131218 CAGGCTAATTTTTGTATTTTGGG - Intronic
1017787534 6:157768876-157768898 CAGGCTAATTTTTGTATTTTTGG - Intronic
1018012825 6:159687321-159687343 CCGGCTAATTTTTATATTTTTGG - Intronic
1018254644 6:161905797-161905819 CAGGCTAATTTTCATATTTTTGG - Intronic
1018453581 6:163931575-163931597 CACTCTCATTTTTATTTGCTCGG + Intergenic
1018697043 6:166398285-166398307 CAGGATAATTTTTTTTGGAGGGG + Intergenic
1019844045 7:3479258-3479280 CTGGCTAATTTTTATGTTTTTGG - Intronic
1020189795 7:5986528-5986550 CTGGCTAATTTTTATATTTTTGG - Intronic
1020293125 7:6738140-6738162 CTGGCTAATTTTTATATTTTTGG + Intergenic
1020918247 7:14226094-14226116 CAGGTTATTTATTATGTGATTGG - Intronic
1020941963 7:14551183-14551205 CATGCAAATATCTATTTGATAGG + Intronic
1021078679 7:16336633-16336655 CAAGCTAATTATTATCAGATAGG - Intronic
1021273342 7:18619601-18619623 GGGGCTTATTTTTATTTGAATGG + Intronic
1021439699 7:20663875-20663897 CCGGCTAATTTTTATATTTTTGG + Intronic
1021560154 7:21961559-21961581 CCGGCTAATTTTTGTATTATTGG + Intergenic
1021681527 7:23138012-23138034 CAGGCTAATTTTTGTATTTTTGG - Intronic
1021694513 7:23263448-23263470 CCGGCTAATTTTTATATTTTCGG - Intronic
1021826221 7:24554507-24554529 CAGCCTAAATTTTCATTGATAGG + Intergenic
1021870820 7:25004497-25004519 CATACTCATTTTTATTTGACTGG - Intergenic
1022682960 7:32567261-32567283 CTGGCTAATTTTTGTATTATTGG + Intronic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1023154688 7:37236973-37236995 CAGGAACATTTTTATTTGTTTGG + Intronic
1023412955 7:39905586-39905608 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1025619706 7:63157401-63157423 CTGGCTAATTTTTAATTTTTTGG - Intergenic
1025624080 7:63202770-63202792 CAGGCTAATTTTTATATTTTTGG - Intergenic
1025696236 7:63776505-63776527 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1026038058 7:66844206-66844228 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1026116362 7:67499093-67499115 CTGGCTAATTTTTATATTTTTGG - Intergenic
1026163866 7:67892994-67893016 CTGCCTAATTTTTGTTTGTTTGG - Intergenic
1026399356 7:69993570-69993592 CTGGCTAATTTTTGTTTAAAAGG - Intronic
1026651685 7:72221477-72221499 CTGGCTAATTTTTTTGTGTTAGG + Intronic
1026687584 7:72524574-72524596 CTGGCTAATTTTTGTTTTTTTGG + Intergenic
1026689478 7:72539611-72539633 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1026993028 7:74598452-74598474 CCGGCTAATTTTTTTTTTTTTGG - Intronic
1027127044 7:75564051-75564073 CTGGCTAATTTTTAATTTTTTGG + Intronic
1027145869 7:75694079-75694101 CCGGCTAATTTTTATATTTTTGG + Intronic
1027810327 7:82888670-82888692 TAGTCTAAGTTTAATTTGATAGG - Intronic
1028272362 7:88808218-88808240 CTGGCTAATTTTTAGTAGAAGGG - Intronic
1028281086 7:88928675-88928697 CATGCCAATTTTAATTTGAAGGG - Intronic
1028915060 7:96250019-96250041 CTGGCTAATTTTTATATTTTTGG - Intronic
1028941084 7:96522727-96522749 CCGGCTAATTTTTTTTTGGGGGG - Intronic
1029131149 7:98332219-98332241 CCGGCTAATTTTTATATTTTTGG - Intronic
1029680057 7:102102263-102102285 CTGGCTAATTTTTGTGTGAAAGG - Intronic
1030036567 7:105412529-105412551 CCAGCTAATTTTTTTTTGGTAGG + Intergenic
1030040964 7:105449448-105449470 CAGGCTAATTTTTGTATTTTTGG - Intronic
1030054033 7:105566114-105566136 CTGGCTAATTTTTTTTTTTTTGG - Intronic
1030282115 7:107787576-107787598 CATGTTTATTTTTATTTGTTTGG - Intronic
1030355936 7:108542622-108542644 CCAGCTAATTTTTGTTTTATTGG + Intronic
1030622661 7:111807896-111807918 CAGGGTGATTTTTTTTTAATAGG - Intronic
1030972091 7:116072092-116072114 TAAGTTAATTTTTATTTTATGGG + Intronic
1031025938 7:116680249-116680271 ATGCCTAATTTTTATTTCATTGG + Intronic
1031035285 7:116781727-116781749 CAGGCTAATTTTTTTGTGGGCGG + Intronic
1031215482 7:118884784-118884806 CAGGCTAATTTTTGTGTTTTTGG - Intergenic
1031426144 7:121608046-121608068 CTGGCTAATTTTTATATTTTTGG - Intergenic
1031811171 7:126371072-126371094 CAGGCTAATTTTTGTGTTTTTGG - Intergenic
1031899615 7:127393877-127393899 CCGGCTAATTTTTTTTTATTTGG - Intronic
1032335630 7:131022070-131022092 CCGGCTAATTTTTTTTTTCTTGG - Intergenic
1032376686 7:131426914-131426936 CAGGCTAATTTTTGTATTTTTGG + Intronic
1032664035 7:134017009-134017031 CAGATAAATTTTTATTTGATAGG - Intronic
1033154652 7:138946615-138946637 CAGGCTAATTTTTGTATTTTTGG - Intronic
1033177310 7:139136610-139136632 CTGGCTAATTTTCGTTTGATTGG + Intronic
1033182775 7:139197120-139197142 CTGGCTAATTTTTATATTTTTGG + Intergenic
1033215890 7:139493339-139493361 CTGGCTAATTTTTGTATTATTGG + Intergenic
1033337345 7:140464950-140464972 CCAGCTAATTTTTATTTTGTAGG + Intronic
1033518326 7:142131750-142131772 CAGGCTAATTTTTATTTGATGGG + Intronic
1033665131 7:143433658-143433680 AATGCTATTTTTTATTTGAGAGG + Intergenic
1034119559 7:148615098-148615120 CTGGCTAATTTTTATATTTTTGG + Intronic
1034170816 7:149061621-149061643 CCGGCTAATTTTTTTTTTTTTGG - Intergenic
1034525814 7:151661337-151661359 CCGGCTAATTTTTATGTTTTTGG + Intronic
1034975536 7:155447294-155447316 CAGACTAATTTTTTTTTGTTTGG + Intergenic
1035849500 8:2901308-2901330 CAGGCTGAGGTTTCTTTGATTGG - Intergenic
1036008568 8:4694515-4694537 CAGGCTAATTTTTTTTGGGGGGG + Intronic
1037143214 8:15541940-15541962 CACGCCAATTTTCATTTGAAGGG + Intronic
1037798521 8:22017249-22017271 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
1038099652 8:24359159-24359181 CTGGCTAATTTTTGTATTATTGG - Intergenic
1038120990 8:24615065-24615087 CCGGCTAATTTTTTTTTGTAGGG - Intergenic
1038202238 8:25423955-25423977 CAAGTTAATTTTCATTTGATGGG + Exonic
1038238633 8:25786698-25786720 CAATCTCAATTTTATTTGATTGG + Intergenic
1038472162 8:27834187-27834209 CTGGCTAATTTTTATATTTTTGG + Intronic
1038656598 8:29458256-29458278 CTGGCTAATTTTTATATTTTTGG - Intergenic
1040056574 8:43063289-43063311 CAGGCTAATTTTAAACTGCTGGG + Intronic
1040689902 8:49924065-49924087 CAGGTTAATTTTTAATGAATAGG + Intronic
1040939260 8:52816074-52816096 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1040959154 8:53012725-53012747 CTGGCTAATTTTTATATTTTTGG - Intergenic
1041202061 8:55459366-55459388 TAGGCAAAATTTTACTTGATTGG + Intronic
1041281479 8:56214230-56214252 CAGGCTAATTTTTGTATTTTTGG + Intronic
1042016889 8:64322861-64322883 CAGGTATATTTGTATTTGATTGG - Intergenic
1042134540 8:65620461-65620483 CTGGCTAATTTTTATATTTTTGG + Intronic
1042179016 8:66066044-66066066 CAGGCTATTTTTTAGATAATTGG + Intronic
1042824339 8:72964917-72964939 CAGGCCAATTTAAATTTGCTGGG + Intergenic
1043113579 8:76219028-76219050 CAGGTTCATTTTTCTTTCATTGG + Intergenic
1043803648 8:84643570-84643592 CAGTCTAATTTCTGTATGATGGG - Intronic
1044146428 8:88720560-88720582 CATTCTAATTTTTGTTTTATGGG + Intergenic
1044287925 8:90431150-90431172 CTGGCTAATTTTTATATTTTTGG - Intergenic
1044371858 8:91421191-91421213 CCGGCTAATTTTTTTTTTTTTGG + Intergenic
1044673848 8:94710186-94710208 CTGGCTAATTTTTATATTTTTGG - Intergenic
1044720282 8:95139065-95139087 CATTTTAATTTTTATTTGATTGG + Intronic
1044838646 8:96319073-96319095 CTGGCTAATTTTTGTATTATTGG + Intronic
1044976907 8:97673811-97673833 CTGGCTAATTTTTATATTTTTGG - Intronic
1044978204 8:97687811-97687833 AAGGCAAATTTTAATTTAATAGG - Intronic
1044986156 8:97758031-97758053 CCGGCTAATTTTTTTTTTTTTGG - Intergenic
1045078638 8:98599807-98599829 CTGGCTAATTTTTGTTTTTTGGG - Intronic
1045127254 8:99105538-99105560 CTGGCTAATTTTTATATTTTTGG + Intronic
1045161489 8:99551563-99551585 CATTCTAATTTTTATTTATTTGG + Intronic
1045487064 8:102640147-102640169 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1045641532 8:104256935-104256957 CTGGCTAATTTTTATATTTTTGG - Intergenic
1045762568 8:105628114-105628136 GGGGCTAATTTTTATTTCAGAGG - Intronic
1046916960 8:119688171-119688193 CTGGCTAATTTTTATATTTTTGG + Intergenic
1047487462 8:125344579-125344601 CTGGCTAATTTTTATATTTTTGG - Intronic
1047912345 8:129544076-129544098 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1048404127 8:134101767-134101789 CCGGCTAATTTTTATATTTTTGG - Intergenic
1049604413 8:143522439-143522461 CCGGCTAATTTTTATGTTTTTGG - Intronic
1049701398 8:144015199-144015221 CTGGCTAATTTTTTTTTTTTTGG + Intronic
1050102824 9:2136347-2136369 CTGGCTAATTTTTATATTATTGG + Intronic
1050521160 9:6501817-6501839 CAGCCTAATTATTCTCTGATTGG + Intronic
1050859387 9:10407056-10407078 CATTATAATATTTATTTGATGGG - Intronic
1051383123 9:16479088-16479110 CTGGCTAATTTTTATTTTTTTGG - Intronic
1051400519 9:16677087-16677109 CTGTCTAATTTTTATGTGCTTGG + Intronic
1051449008 9:17174532-17174554 CCGGCTAATTTTTATATTTTTGG - Intronic
1052532041 9:29698426-29698448 TAAGATAATTTTTATTTGATGGG + Intergenic
1052937488 9:34105089-34105111 CAGGCTAATTTTTCTATTTTTGG - Intronic
1054171623 9:61845352-61845374 CAGCCTAATTCTTATTCAATAGG + Intergenic
1054665911 9:67735460-67735482 CAGCCTAATTCTTATTCAATAGG - Intergenic
1054741256 9:68808034-68808056 CAGGCTAATTTTTGTATTTTTGG - Intronic
1055353491 9:75413590-75413612 CAGGCTGATTTGTCTTTTATCGG + Intergenic
1055379771 9:75693455-75693477 CTGGCTAATTTTTGTATTATGGG - Intergenic
1055518641 9:77058571-77058593 CTGGCTAATTTTTATATTTTTGG - Intergenic
1055530646 9:77179396-77179418 CCGGCTAATTTTTAGTAGAGAGG + Intronic
1055683154 9:78739906-78739928 CAGTATATTATTTATTTGATGGG - Intergenic
1055712953 9:79085347-79085369 GAGGCCAATTTTTGTTTGTTTGG - Intergenic
1055753430 9:79532008-79532030 CTGGCTAATTTTTTTTTTTTTGG - Intergenic
1055935540 9:81601115-81601137 CAGCCCTCTTTTTATTTGATGGG - Intronic
1056622654 9:88226969-88226991 CAGGCTAATTTTTATATTTTCGG - Intergenic
1056636745 9:88337583-88337605 CTGGCTAATTTTTACATTATTGG - Intergenic
1058032738 9:100217145-100217167 CTGGCTAATTTTTATATTTTTGG - Intronic
1058064683 9:100535607-100535629 CTGGCTAATTTTTATATTTTTGG - Intronic
1058083256 9:100721608-100721630 CCAGCTAATTTTTATTTTTTTGG + Intergenic
1058848183 9:108982914-108982936 CTGGCTAATTTTTATATTTTTGG - Intronic
1059875280 9:118627915-118627937 TAGGCTAATTATTATTTCATTGG + Intergenic
1060472305 9:123958360-123958382 CCAGCTAATTTTTGTTTGTTTGG - Intergenic
1060500765 9:124152441-124152463 CCAGCTAATTTTTTTTTGGTGGG - Intergenic
1060578026 9:124716039-124716061 CAGGCTAATTTTTAAATTTTTGG - Intronic
1060649097 9:125309494-125309516 CCGGCTAATTTTTATATTTTTGG + Intronic
1060662992 9:125415271-125415293 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1060800361 9:126540761-126540783 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1061206762 9:129168678-129168700 TAGGCTAATTTTTGTATGTTTGG + Intergenic
1061243224 9:129386494-129386516 CTGGCTAATTTTTATATTTTTGG - Intergenic
1061527928 9:131183244-131183266 CTGGCTAATTTTTATATTTTTGG + Intronic
1061631639 9:131875773-131875795 CCAGCTAATTTTTATTTTTTTGG + Intronic
1061831353 9:133297651-133297673 CAGCCTTATTATTATTTGACTGG - Intergenic
1062198669 9:135288821-135288843 CAGGCTAATTCCTACTTGCTGGG + Intergenic
1062296350 9:135829689-135829711 CTGGCTAATTTTTGTTTTTTCGG - Intronic
1185555741 X:1019774-1019796 CCGGCTAATTTTTGTATTATTGG - Intergenic
1186010017 X:5119823-5119845 AAGGTTAATTTTTATTTAAGAGG + Intergenic
1186491541 X:9977391-9977413 CTGGCTAATTTTTATGTTTTTGG + Intergenic
1187946992 X:24435769-24435791 CTGGCTAATTTTTATATTTTTGG + Intergenic
1188298522 X:28480143-28480165 CTGGCTAATTTTTGTATTATTGG - Intergenic
1188482465 X:30649592-30649614 CAGGCACATTGTTATTTTATGGG - Intergenic
1188495745 X:30781358-30781380 CAAGTTAATTTTTATCTGCTAGG + Intergenic
1189534211 X:41920579-41920601 CAAGCTAATTTTGAGGTGATAGG - Intronic
1189803378 X:44712140-44712162 CTGGCTAATTTTTATATTTTTGG + Intergenic
1190201550 X:48365920-48365942 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1191079845 X:56498227-56498249 CAAGATACTTTTTATATGATTGG + Intergenic
1191669290 X:63734317-63734339 CAAGCTAATGTTTATCAGATTGG - Intronic
1192145118 X:68676982-68677004 CTGGCTAATTTTTTTTTTTTTGG - Intronic
1192531120 X:71886983-71887005 CAGGCTACTTTTGCTTTGACTGG - Intergenic
1194481913 X:94437080-94437102 CTGGCTCCTTTTTATTTGTTTGG - Intergenic
1195026060 X:100878794-100878816 CAGGCTAATTTTTGTATTTTTGG - Intergenic
1195387727 X:104328927-104328949 CTGGCTAATTTTTGTATGTTTGG - Intergenic
1196156495 X:112436053-112436075 CAGGCTAATTTTTGTATTTTAGG - Intergenic
1196641970 X:118072930-118072952 CTGGCTAATTTTTAAATGTTTGG - Intronic
1196688505 X:118533151-118533173 CTGGCTAATTTTTATATTTTTGG + Intronic
1196860597 X:120023930-120023952 CAGGCTAATTTTTTTTTTTTTGG + Intergenic
1197055884 X:122117886-122117908 CAGGCAAATTATTTTTTTATTGG + Intergenic
1197215821 X:123865914-123865936 CTGGCTAATTTTTTTTTTTTTGG + Intronic
1197295217 X:124710661-124710683 TAAACTAATTTTTATTTGAGTGG + Intronic
1197312825 X:124927346-124927368 CAGGCTAGTTTTTATGTAAGTGG - Intronic
1197554210 X:127934651-127934673 CAGGTTAATTTCTTTTTGAAAGG - Intergenic
1197555174 X:127944347-127944369 CTGGCTAATTTTTGTATGACAGG + Intergenic
1197797389 X:130312309-130312331 CTGGCTAATTTTTATTTGTTTGG + Intergenic
1197899318 X:131352964-131352986 CAAGCTAATTCTCATTTAATAGG + Intronic
1197914347 X:131519148-131519170 CAGGCTGATTTTTTTTTTTTTGG + Intergenic
1199157750 X:144570708-144570730 TTTGCTAATTTTTATTTGATAGG + Intergenic
1199368111 X:147012359-147012381 CTGGCTAATTTTTATATTTTTGG + Intergenic
1200784062 Y:7243536-7243558 CAGGCTAATCTTTAATTCCTGGG + Intergenic
1201262570 Y:12174612-12174634 CAGGCTAATTTTTGTATTTTTGG + Intergenic
1201546589 Y:15170817-15170839 CAGGGTAATTATGATATGATGGG + Intergenic
1201669755 Y:16505889-16505911 AAGGTTAATTTTTATTTCAGAGG - Intergenic