ID: 1033518444

View in Genome Browser
Species Human (GRCh38)
Location 7:142134046-142134068
Sequence CAGCCCATACACATTGGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033518444_1033518452 28 Left 1033518444 7:142134046-142134068 CCAGTGCCAATGTGTATGGGCTG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1033518452 7:142134097-142134119 ACAATATGACCTGGAAGACTTGG 0: 1
1: 0
2: 1
3: 7
4: 162
1033518444_1033518449 19 Left 1033518444 7:142134046-142134068 CCAGTGCCAATGTGTATGGGCTG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1033518449 7:142134088-142134110 AGTACCGCCACAATATGACCTGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033518444 Original CRISPR CAGCCCATACACATTGGCAC TGG (reversed) Exonic
901197550 1:7448515-7448537 CAGCCCAGACAGACTGGGACAGG - Intronic
901343845 1:8520679-8520701 CAGCCCCTAAACTTTGCCACAGG - Intronic
909527879 1:76647282-76647304 AATCCCAGACACATTGGCACTGG + Intergenic
909597131 1:77418788-77418810 CAGCCATTACACATGGACACTGG - Intronic
911500827 1:98682276-98682298 CAGCCCATATACACTGGACCAGG - Intronic
924414885 1:243849552-243849574 CAACCCAAACACACTGACACCGG + Intronic
1062872716 10:920490-920512 CAGGCCAGACACAGTGGCTCAGG + Intronic
1064188967 10:13188728-13188750 CAGCCCTTCCACATTGGGAACGG + Intronic
1065213514 10:23427442-23427464 CTGTCCATATACATTGGCAGGGG - Intergenic
1066173557 10:32878994-32879016 CAGGCCATTCAAATTGGCAAGGG + Intronic
1066621621 10:37359812-37359834 GAACCCATACACATTAGAACTGG + Intronic
1068004080 10:51371978-51372000 CAACCAGTACACATTGCCACTGG + Intronic
1071005187 10:80876079-80876101 CAGGACATATACATTGGCAAAGG - Intergenic
1072456982 10:95585156-95585178 CAGGCCACACGCATTGGCAGAGG - Intergenic
1074606543 10:114975132-114975154 CAGCTCTAGCACATTGGCACAGG - Exonic
1075181818 10:120218029-120218051 CAGCCCATACTCAGTGGGAGGGG + Intergenic
1077054440 11:584090-584112 CGGCCAACACACATTGGCTCAGG - Intronic
1078325143 11:10374613-10374635 TAGCCCAAACAGATAGGCACAGG - Intronic
1078339653 11:10489599-10489621 CAGTCCATAAACATGGGCGCAGG + Intronic
1079921218 11:26436569-26436591 CAGCCCCAACACACTGGCAGGGG + Intronic
1081315837 11:41628871-41628893 CAGCCCATACACCTTTAAACTGG - Intergenic
1084947933 11:72648910-72648932 CAGCTCCTACACAGAGGCACAGG + Intronic
1085151250 11:74254256-74254278 CAGCCCATGCACAAAGCCACAGG + Exonic
1085369923 11:75992540-75992562 CAGCCCACAAACATTCGCAATGG - Intronic
1085803809 11:79616121-79616143 GAGCCCACACACTTTGCCACTGG + Intergenic
1089701155 11:120244813-120244835 CCGCCCAGACACATTTGCAAAGG - Intronic
1089711062 11:120315099-120315121 CAGGCAATACACATTGTCAGGGG + Intronic
1089768023 11:120782684-120782706 CACCCCCTACACATAGCCACGGG - Intronic
1095636942 12:44446034-44446056 CTGCCCAAACACATTTGCAGTGG - Intergenic
1097840935 12:64320442-64320464 CAGGCCAGGCACAATGGCACAGG - Intronic
1104589605 12:130073845-130073867 TTGCCAGTACACATTGGCACGGG + Intergenic
1104889747 12:132134574-132134596 CGGCCCTTCCACAGTGGCACGGG - Intergenic
1113182568 13:107647636-107647658 CAGGCCATACAAGTTGTCACCGG - Intronic
1115653525 14:35421192-35421214 CAGACCAGACACAGTGGCTCTGG + Intergenic
1117815626 14:59594602-59594624 AAGCCCAAACTCCTTGGCACAGG + Intergenic
1121665676 14:95670458-95670480 CATCCCAGACACATTCACACTGG + Intergenic
1124345053 15:28916590-28916612 CAGCCCATACACACGTGCAAAGG - Intronic
1127354752 15:58187751-58187773 CAGCCCATACACAGAAGCAATGG + Intronic
1128319427 15:66682581-66682603 CAGCCCATACTCAATGGGAGAGG - Intronic
1128363717 15:66982028-66982050 CAGCCAATACACACAGGCCCGGG - Intergenic
1128506077 15:68273764-68273786 CAGCCCTTCCCCATTGGCATGGG + Intergenic
1129608874 15:77037884-77037906 CAGCCCAGGCACGTTGGCCCCGG + Intergenic
1130035322 15:80355271-80355293 CAGCCCATACTCAAGGGCAGGGG + Intronic
1130037542 15:80375387-80375409 CAGCCCATAGACATATGCCCTGG - Exonic
1130406539 15:83607903-83607925 CAACCCACACACATTGGACCTGG + Intronic
1130993813 15:88892962-88892984 CAGCCCAGTCACCTTGGCAGTGG + Intronic
1137791832 16:51181583-51181605 CTGCCCCCACACATTGTCACTGG - Intergenic
1138039328 16:53645753-53645775 AAGTCCATATTCATTGGCACTGG + Exonic
1138539028 16:57677196-57677218 CACCCCATGCACATTGGCACAGG - Intronic
1139694127 16:68661273-68661295 CAACCCAGACACAGTGGCTCTGG - Intronic
1140236670 16:73165447-73165469 CAGCAAAGACACATTGCCACAGG - Intergenic
1143447413 17:7017662-7017684 CAGCACAGAAATATTGGCACAGG - Intergenic
1150867631 17:68870381-68870403 CACCCCAAACACAGTGGCAGGGG - Intronic
1152179190 17:78807256-78807278 CAGCCCATGCCCGTTGGCAGTGG + Exonic
1156862402 18:41853447-41853469 CATCCCAGACACAATGCCACTGG + Intergenic
1158485836 18:57864963-57864985 CAGCACCTACACACTGGCCCAGG - Intergenic
1161041116 19:2111228-2111250 CAGCCCACACTCTTTGGCATGGG - Intronic
1166126768 19:40719260-40719282 CAGCCCCTGCACACAGGCACAGG - Intronic
1167333922 19:48873222-48873244 CAGCCCAGACACATGGCCCCAGG + Exonic
927768048 2:25831377-25831399 CAGGCCAGGCACAATGGCACAGG + Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
930874233 2:56195572-56195594 CAGCCTATAAACATGGGCATTGG + Intronic
933632489 2:84673431-84673453 CTGACCACACACATTAGCACAGG - Intronic
934219081 2:90065013-90065035 CAGCACAGACAAAGTGGCACAGG + Intergenic
935023016 2:99249927-99249949 CAGCCCATGCATATTCCCACAGG - Intronic
936957832 2:118041029-118041051 CAGCCCGCAAACATTGTCACTGG - Intergenic
943501703 2:188698394-188698416 CAGGACATACACATGGGCAAAGG - Intergenic
944669751 2:201985002-201985024 CACCCCACAGACATTGGCTCAGG - Intergenic
944916200 2:204363141-204363163 CAGCCCATGCACAGTGTCGCTGG + Intergenic
945344540 2:208697424-208697446 CAGCCCACACTCACTGGCAGAGG - Intronic
946271024 2:218594416-218594438 CAGCCCATACACCTCAGCAGGGG - Exonic
947063607 2:226194829-226194851 TAACCCCTACCCATTGGCACCGG + Intergenic
947651245 2:231787857-231787879 CTGCCTATACACAGAGGCACCGG - Intronic
1169215817 20:3794434-3794456 CAGCCAATATACATCTGCACAGG - Intronic
1171425428 20:25045709-25045731 AAGCCCCTAGACATTGGCACTGG - Intronic
1173131320 20:40396694-40396716 CTGCCCATACACCTTGGGAAAGG - Intergenic
1173609211 20:44354507-44354529 CAGCCCCTACAGATGGGCATGGG - Intergenic
1173666663 20:44767973-44767995 CAGCCCAGAAACACTGGCATGGG - Intronic
1174255653 20:49252801-49252823 CAGATCATACACGTTGGCACTGG + Exonic
1175103192 20:56594897-56594919 AAGTCCAAACACATTAGCACAGG + Intergenic
1175914918 20:62421645-62421667 CAGCACATACACATGCACACTGG - Intronic
1179040508 21:37798278-37798300 CAGCCCCTCCACATGGGCTCTGG + Intronic
1179543962 21:42101910-42101932 CAGCCCATACCCACGGGAACTGG - Intronic
1183949256 22:41343566-41343588 CAGCCCACCCACCTTTGCACAGG - Exonic
1184912628 22:47546592-47546614 CAAGACAGACACATTGGCACAGG - Intergenic
949647783 3:6117636-6117658 CAGTCCATACATAGTGGCTCGGG - Intergenic
951940121 3:28068799-28068821 CATCCCACACACATTTTCACTGG - Intergenic
952046138 3:29323111-29323133 AAGCTCAGACACATTGTCACTGG + Intronic
953095471 3:39770360-39770382 CAGCCCATACTCATAGGACCTGG + Intergenic
955328811 3:58030184-58030206 CACCCCATACACAATGTCTCAGG - Intronic
959043116 3:101441488-101441510 CAGCCCATACACACTGTCAAGGG + Intronic
960084430 3:113575423-113575445 CAGCCCACACAAAGTGTCACAGG + Intronic
967772004 3:193344306-193344328 CAGCAGATACACAAGGGCACTGG + Intronic
967841747 3:194010460-194010482 AAGCCCATCCACAGTGGCCCTGG - Intergenic
968453353 4:685325-685347 CACACAATACACATGGGCACAGG + Intronic
971805720 4:31355814-31355836 CAGCCCTTGCATATGGGCACTGG + Intergenic
983685809 4:170407484-170407506 CATCCCATTCACTTTGGGACAGG - Intergenic
997360550 5:133292048-133292070 CAGCCCATGGAGATGGGCACTGG + Intronic
997511603 5:134458492-134458514 CAGCCCACGCACCCTGGCACAGG - Intergenic
1001435536 5:171696382-171696404 TAGCCCAGACAGATGGGCACAGG + Intergenic
1009498801 6:64384879-64384901 CAGCACATACACATTGGATTAGG + Intronic
1011868961 6:91868555-91868577 GCCCCCATACACATAGGCACAGG - Intergenic
1012106147 6:95161043-95161065 CAACCCAAACAAAATGGCACTGG - Intergenic
1014090156 6:117395431-117395453 CACTCAATACCCATTGGCACAGG + Intronic
1015383373 6:132594729-132594751 CATGCCATGCAAATTGGCACAGG - Intergenic
1026302388 7:69109136-69109158 CAGCACATAGTCATTGGCAGAGG + Intergenic
1033518444 7:142134046-142134068 CAGCCCATACACATTGGCACTGG - Exonic
1034421574 7:150993655-150993677 TATCCCATACACAATGGGACAGG - Intronic
1036418280 8:8571282-8571304 GAGGCCACACAGATTGGCACTGG + Intergenic
1042208066 8:66348763-66348785 GAGCCCAGACAAACTGGCACTGG - Intergenic
1048366275 8:133741396-133741418 CATCCCATCTACATTTGCACTGG - Intergenic
1049611668 8:143558778-143558800 CAGCCCCTCCACAGTGGCCCAGG + Intronic
1052412391 9:28138898-28138920 CAGTCCTTACATATTGGAACTGG - Intronic
1055666255 9:78555954-78555976 CAGCCCATTCACAATCGCAGGGG - Intergenic
1056845558 9:90034284-90034306 CAGCTCATTCACGTTGACACAGG - Intergenic
1059612365 9:115912287-115912309 CAGCCCAAACACATTTGCTCTGG + Intergenic
1060212941 9:121721553-121721575 CAGCCCCTGCACCATGGCACTGG + Intronic
1062263486 9:135675458-135675480 AAGCCCATCCACACAGGCACTGG + Intergenic
1187291308 X:17956126-17956148 AAGCACATAAATATTGGCACGGG - Intergenic
1187590281 X:20710087-20710109 CAGACCACAAACATTGGCCCTGG - Intergenic
1188222563 X:27558803-27558825 CAGCTCAGACACATGGACACAGG - Intergenic
1193239005 X:79144040-79144062 CAGCCCAGACCCATTGCCACAGG - Intergenic
1197390056 X:125851820-125851842 GAGCCAATTCACATTGGCTCAGG - Intergenic
1199547891 X:149027065-149027087 CAGCCCATACTCACGGGCAGGGG + Intergenic
1201583393 Y:15534574-15534596 CAGCCCATACTCAGTGGGAGGGG + Intergenic