ID: 1033521582

View in Genome Browser
Species Human (GRCh38)
Location 7:142166343-142166365
Sequence AGGCGTGTTGCACAGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033521582_1033521586 -1 Left 1033521582 7:142166343-142166365 CCAGGACCCTGTGCAACACGCCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033521582 Original CRISPR AGGCGTGTTGCACAGGGTCC TGG (reversed) Intronic
900245341 1:1633746-1633768 AGGCGTGTGGCTCACGGACCTGG + Exonic
900256572 1:1700905-1700927 AGGCGTGTGGCTCACGGACCTGG + Intronic
901594802 1:10376384-10376406 GGGCTTGTGTCACAGGGTCCCGG + Intronic
901859405 1:12064405-12064427 AGGCGTGTTTCACGGAGCCCAGG + Intronic
903115202 1:21173542-21173564 AGGCGTGTGCCACCAGGTCCAGG - Intronic
906237778 1:44222193-44222215 AGGTGTGTTTCCCAGGGCCCTGG - Intronic
908823707 1:68114026-68114048 AGGTGTGTTTCACAGGATGCTGG - Intronic
922725563 1:227921479-227921501 AGCCCTGCTGCACAGGGTGCAGG - Exonic
1063317493 10:5020657-5020679 AGACGTGTTACACAGGGTGAAGG + Intronic
1067524551 10:47030266-47030288 CGGCGAGTTCCACAGGGCCCAGG + Intergenic
1072407957 10:95171921-95171943 AGATGTGGTGCACAGGGCCCAGG + Intergenic
1073331719 10:102674349-102674371 GGGTGTGTTGCACTGGGTGCAGG + Exonic
1075060758 10:119255218-119255240 AGGGGTGTGGCACAGGCTTCTGG + Intronic
1076517202 10:131053063-131053085 AGTCCTGTGGCACTGGGTCCTGG - Intergenic
1076600587 10:131654650-131654672 AGGCTGGATGCATAGGGTCCAGG - Intergenic
1076919843 10:133445876-133445898 AGGCGTGTGGAGCAGGGGCCTGG + Intergenic
1076947023 10:133658443-133658465 AGGCATGTTCCACAGGCTCAGGG + Intergenic
1078451148 11:11441922-11441944 CAGCCTGTTGCACAGGATCCTGG - Intronic
1080574734 11:33587874-33587896 AGGAGTGTTGCATAGGAGCCAGG + Intronic
1080757817 11:35219060-35219082 AGCAGTGTTGCACAGTGTTCAGG - Intronic
1081525388 11:43924514-43924536 AGGCGAGTGGGACAGGGACCTGG + Intergenic
1084601333 11:70147552-70147574 AGGCGCGTTCCCCAGGCTCCTGG + Intronic
1089498967 11:118921925-118921947 AGGGGTCTTCCACAGGTTCCAGG + Intronic
1091866435 12:3841332-3841354 AGGCCTGGTGCAGAGGGTACAGG - Intronic
1092783409 12:12007581-12007603 AGGAGACTTGCACAGGTTCCGGG + Intergenic
1093071677 12:14712005-14712027 AGGCCTGATGAACAGGGCCCAGG - Intergenic
1095249769 12:39964668-39964690 AGGGTTGGTGCACAGGGTCCTGG + Intronic
1095922102 12:47542043-47542065 AGGAGTATGGCACAGAGTCCTGG + Intergenic
1102240705 12:111322808-111322830 ACGCCTGATGCACTGGGTCCTGG + Intronic
1104168275 12:126255031-126255053 AGGCTTGTTGGCCAAGGTCCTGG + Intergenic
1106693184 13:32141855-32141877 AGGTGAGATGCAGAGGGTCCAGG + Intronic
1114483308 14:23048258-23048280 AGACGTGTTGCCCCGGGCCCGGG - Exonic
1202921086 14_KI270723v1_random:30996-31018 AGGCATGTTACACAGGCTCAGGG + Intergenic
1202923824 14_KI270724v1_random:6582-6604 AGGCATGTTACACAGGCTCAGGG - Intergenic
1129566095 15:76625107-76625129 AAGCATGTTGCCCAGGGGCCTGG - Intronic
1135074140 16:19378978-19379000 AGCCATGTTGCCCAGGATCCTGG - Intergenic
1135680032 16:24448450-24448472 AGGCGTGTGCCACAGCGCCCAGG - Intergenic
1136605442 16:31330453-31330475 AGGCGTGGTGCTCAGGGCCCAGG + Intronic
1141731303 16:85824901-85824923 AGATGTGTTCCACACGGTCCTGG + Intergenic
1143719495 17:8799532-8799554 AGGCGTTTAGCTCAGGCTCCTGG - Intergenic
1143796146 17:9338330-9338352 AGGCGTGAGCCACAGCGTCCAGG + Intronic
1147674154 17:42193296-42193318 AGGTGTGTTTCCCAGGGTCTGGG - Exonic
1148001358 17:44389353-44389375 AGGTGAGCTGCACTGGGTCCAGG + Exonic
1148229094 17:45920080-45920102 AGGCGTGGAGCACAGGAGCCAGG + Intronic
1148973513 17:51505889-51505911 AAGGGTGGGGCACAGGGTCCAGG + Intergenic
1151803136 17:76389358-76389380 AGGCATGTGGCAGTGGGTCCTGG - Intergenic
1159024023 18:63166388-63166410 ATGCGTGCTGTCCAGGGTCCAGG - Intronic
1160476128 18:79189947-79189969 AACTGTGATGCACAGGGTCCTGG + Intronic
1167307439 19:48717076-48717098 AGGCGAGGTGCAAAGGGGCCAGG - Intronic
1167628268 19:50606642-50606664 AGGGGTGTTGCACACGGTGCAGG + Intergenic
1167845496 19:52160513-52160535 AAGCTTTCTGCACAGGGTCCAGG + Exonic
1167860778 19:52282167-52282189 AAGCCTTCTGCACAGGGTCCAGG - Exonic
928329452 2:30346631-30346653 AGGCGTCTGGGACAGGTTCCCGG - Intergenic
928919799 2:36514738-36514760 AGTCTTGTTGCACAAGGACCAGG - Intronic
933067712 2:77818827-77818849 AGGCATGTTCCACAATGTCCAGG + Intergenic
934460827 2:94213083-94213105 AGCCATGTTACACAGGGGCCAGG - Intergenic
938668721 2:133566354-133566376 AGGCATTTTGCACTGGGTACAGG - Intronic
1168890427 20:1292451-1292473 AGGAATTTTGAACAGGGTCCAGG + Intronic
1173360831 20:42343064-42343086 AGGCATGGTGCACAGGGTGTGGG - Intronic
1174587081 20:51617752-51617774 AGGCGGCTTGCCAAGGGTCCCGG + Intronic
1175725558 20:61315984-61316006 AGGCGATTTCCACAGGGCCCTGG + Intronic
1175726306 20:61320896-61320918 GGGCGGGGTGCACAGGCTCCAGG + Intronic
1175956168 20:62610501-62610523 AGGGGTGTGGCAAAGAGTCCTGG - Intergenic
1178914986 21:36701107-36701129 AGGCGCGCTGCTCAGGGTTCTGG + Intronic
1180594402 22:16963878-16963900 AGGTGTGTTCCACTGGGTGCTGG - Intronic
1181308981 22:21933561-21933583 AGGCGCGGTTCACAGGGTCCTGG + Exonic
1181434412 22:22901834-22901856 TGGCTTGTTGCATAGGGTCAGGG - Intergenic
1185272827 22:49936516-49936538 ACGCGTGTGGCACAGGGAGCCGG + Intergenic
953850674 3:46463734-46463756 TGGCCTGTTGCACAGGGTTAGGG - Intronic
957080440 3:75631973-75631995 AGGCATGTTCCACAGGCTCAGGG - Intergenic
961569408 3:127787177-127787199 AGGCGTCTTGCCCAGGGGGCTGG - Intronic
962082925 3:132159662-132159684 AGGCTTTTTGCACAGCGTTCAGG - Intronic
972359344 4:38313339-38313361 AGGCGTGTTGGACTGACTCCTGG + Intergenic
981471338 4:145138593-145138615 AGGCCTGGTGCAGAGGGTACAGG + Exonic
985450481 4:190059242-190059264 AGGCATGTTCCACAGGCTCAGGG + Intergenic
985967144 5:3346360-3346382 CAGCGAGCTGCACAGGGTCCGGG - Intergenic
987071596 5:14342134-14342156 AGGCTTCTTGCACTGGGGCCGGG + Intronic
991307231 5:65190613-65190635 AGAAGTGTTGCAAAGGGTCAGGG + Intronic
992162260 5:74015040-74015062 TGGTGTGTCACACAGGGTCCTGG + Intergenic
995459408 5:112387255-112387277 TGGTGGTTTGCACAGGGTCCGGG - Intronic
999269098 5:150286085-150286107 AGGCGTGCTGCACCAGCTCCAGG - Intronic
1001400778 5:171445229-171445251 AGGGCTGGTCCACAGGGTCCAGG + Intronic
1001646841 5:173288508-173288530 ATGCGGGGTGCACAGGCTCCAGG + Intergenic
1006215586 6:32439753-32439775 AGGGTTCTTGCAAAGGGTCCAGG - Intergenic
1006247445 6:32751224-32751246 GAGAGTGTTGCACAGGGACCAGG + Intergenic
1007423489 6:41733610-41733632 AGGCGAGTTGCTCGTGGTCCTGG + Intronic
1010197198 6:73251999-73252021 AGGCGTGAGCCACAGGGCCCAGG + Intronic
1010958327 6:82117065-82117087 AAGCTTGTGGCACAGAGTCCAGG + Intergenic
1020302727 7:6808488-6808510 AGGCGTGTGGGGCAGGGCCCAGG - Intronic
1021461643 7:20894147-20894169 AGTCATATTGCACAGGGGCCTGG - Intergenic
1021741269 7:23687921-23687943 AGGCATGTGCCACAGGCTCCTGG + Intronic
1022037152 7:26545319-26545341 AGGCGCATTGCACAAAGTCCTGG + Intergenic
1025025749 7:55514968-55514990 AAGTGTGTTACACAGGGTCCAGG - Intronic
1026664019 7:72326342-72326364 AGAGATGTTGCACAGGGTCACGG - Intronic
1030532232 7:110726092-110726114 AGGAGTTATGCACAGAGTCCGGG - Intronic
1033521582 7:142166343-142166365 AGGCGTGTTGCACAGGGTCCTGG - Intronic
1052998735 9:34565683-34565705 AGGCGTGATGGACAGAGCCCAGG + Intronic
1056167998 9:83956987-83957009 AGGCGTCTTGCTCAGGCTGCGGG - Intergenic
1058670651 9:107358130-107358152 GGGACAGTTGCACAGGGTCCTGG - Intergenic
1061488434 9:130932393-130932415 AGGCGTGGAGCACTGAGTCCTGG - Intronic
1062429959 9:136522636-136522658 AGGAGGCTTGCACAGGGTCCAGG - Intronic