ID: 1033521583

View in Genome Browser
Species Human (GRCh38)
Location 7:142166349-142166371
Sequence GGCAAAAGGCGTGTTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033521583_1033521586 -7 Left 1033521583 7:142166349-142166371 CCCTGTGCAACACGCCTTTTGCC 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033521583 Original CRISPR GGCAAAAGGCGTGTTGCACA GGG (reversed) Intronic
900773962 1:4567722-4567744 GGCAAAAGGCATGTCTCACATGG - Intergenic
900835988 1:5004487-5004509 GGCAAAAGGCATGTCTTACATGG + Intergenic
902204672 1:14859314-14859336 GGCAAAATACTTCTTGCACATGG - Intronic
902232561 1:15037010-15037032 GGGAAGAGGCGCGCTGCACAGGG - Intronic
902829919 1:19005815-19005837 GGCAAAAGGCATGTCTTACATGG - Intergenic
906160459 1:43645036-43645058 GGCAAAAGCCACGTTGCAAAGGG + Intergenic
906370095 1:45246593-45246615 GGCAAAAGGCATGTCTTACATGG - Intronic
907624953 1:56021070-56021092 GGTGAAAGGCATGTTTCACAGGG + Intergenic
907956544 1:59233452-59233474 GGCAAAAGGCATGTGTTACATGG - Intergenic
909755408 1:79219926-79219948 GGCAAAAGGCATGTCTTACATGG - Intergenic
910192706 1:84610905-84610927 GGCAAAAGGCATGTCTTACATGG - Intergenic
910481688 1:87664897-87664919 GGCAAAAGGCATGTCTTACATGG - Intergenic
911197690 1:95012105-95012127 GGCAAAAGGCACGTTTTACATGG - Intronic
911465977 1:98252432-98252454 GGTAAAAGGCATGTCTCACATGG - Intergenic
911907577 1:103589318-103589340 GGTAAAAGGCATGTCTCACAGGG + Intergenic
913316741 1:117560012-117560034 GGTAAAAGGCATGTCTCACATGG + Intergenic
916390928 1:164330201-164330223 GGCAAAAGGCCTGTCTTACATGG - Intergenic
918949808 1:191122967-191122989 GGCAAGAGGCATGTGTCACATGG + Intergenic
919514165 1:198500983-198501005 GGCAAAAGGCATGTCTTACATGG - Intergenic
919829496 1:201530639-201530661 GGCTAAAGGAGTGTTGCTAATGG + Intergenic
923884059 1:238135646-238135668 GGCAAAAGGCGTATCTTACATGG - Intergenic
924189690 1:241537704-241537726 GGCAAAAGGCATGTCTTACATGG + Intronic
1063505952 10:6599933-6599955 GGCAAAAGGCATGTCTTACATGG + Intergenic
1063878059 10:10500539-10500561 GGCAAAAGGCATGTCTTACATGG - Intergenic
1063909193 10:10812202-10812224 GGCAAAAGGCATGTCTTACATGG + Intergenic
1064281338 10:13954340-13954362 GGCAAAAGGCATGTCTTACATGG + Intronic
1064528849 10:16286076-16286098 GGCAAAAGGCATGTCTTACATGG + Intergenic
1068243429 10:54335630-54335652 GGCAAAAGGCATGTCTTACATGG - Intronic
1068315202 10:55332793-55332815 GGCGAAAGGCGTGTCTTACATGG - Intronic
1069068427 10:63970303-63970325 GGCAAAAGGCATGTCTTACATGG + Intergenic
1069711999 10:70495587-70495609 GGGCAAAAGCTTGTTGCACAAGG + Intronic
1071788429 10:88929271-88929293 GACGAAAGGCGTGTTTTACAGGG + Intronic
1071818136 10:89253341-89253363 GGCAAAAGGCTTGTCTTACATGG + Intronic
1072522674 10:96242257-96242279 GGCAAAAGGCATGTCTTACATGG - Intronic
1073331718 10:102674343-102674365 GGGAAAGGGTGTGTTGCACTGGG + Exonic
1073386880 10:103133189-103133211 GGCAAAAGGCATGTCTCATATGG - Intronic
1073401189 10:103258967-103258989 GGTAAAAGGCATGTCTCACATGG - Intergenic
1073817418 10:107223330-107223352 GGCAAAAGACATGTGTCACATGG + Intergenic
1074128628 10:110552808-110552830 GGCAAAAGGCATGTCTTACATGG - Intergenic
1074506671 10:114077047-114077069 GGTAAAAGGCATGTCTCACATGG + Intergenic
1074609584 10:115008788-115008810 GGCAAAAGGCATGTCTTACATGG + Intergenic
1076200317 10:128552588-128552610 GGTGAAAGGCATGTTTCACATGG - Intergenic
1077288581 11:1778474-1778496 GCCAAAAGGCCTGTTCCCCAGGG + Intergenic
1077870269 11:6256757-6256779 GGCAAAAGGGATTTTGCAGATGG - Intergenic
1079188005 11:18254434-18254456 GGCAACAGGAGTGTTGCATGAGG + Intergenic
1080903043 11:36513714-36513736 GGCAAAAGGCATGTCTTACATGG + Intronic
1081224161 11:40500531-40500553 GGCAAAAGGCACGTTTAACATGG + Intronic
1082630889 11:55540734-55540756 GGTAAAAGGCATGTCTCACATGG + Intergenic
1085681656 11:78580979-78581001 GGCAAAAGGCGTGTCTTACATGG + Intergenic
1086672569 11:89566275-89566297 GGCAAAGGGCGGGGAGCACAAGG - Intergenic
1087009897 11:93503245-93503267 GGCAAAAGGCATGTCTTACACGG + Intronic
1087024581 11:93636991-93637013 GGCAAAAGGCATGTCTTACATGG - Intergenic
1088736654 11:112733165-112733187 GGCAAAAGGCATGTCTTACATGG - Intergenic
1090504420 11:127296503-127296525 GGCAAAAGGCATGTCTTACATGG - Intergenic
1090631267 11:128651180-128651202 GACAAAAGGCGTGTCTCATATGG + Intergenic
1092643159 12:10538728-10538750 GGCAAAAGGCATGTTTTACGTGG + Intergenic
1093570916 12:20664702-20664724 GGCAAAAGGCATGTCTTACATGG - Intronic
1094767076 12:33609181-33609203 GGCAAAAGGCATGTCTTACATGG - Intergenic
1094794326 12:33953083-33953105 GGCAAAAGGCATGTCTTACATGG + Intergenic
1095106178 12:38235692-38235714 GGCAAAAGGCATGTCTTACATGG + Intergenic
1099265248 12:80438134-80438156 GGCAAAAGGCACTTTGCAGATGG - Intronic
1100091451 12:90976899-90976921 GGCAAAAGGCGTATCTTACATGG - Intronic
1101538164 12:105639759-105639781 GGCAAAAGACGTGTTTTACATGG + Intergenic
1107633725 13:42370562-42370584 GGTGAAAGGCGTGTTTCACATGG - Intergenic
1107719055 13:43229150-43229172 GGCAAAAGGCATGTCTTACATGG - Intronic
1107916619 13:45158313-45158335 GGCAAAAGGCATGTCTTACATGG - Intronic
1107964116 13:45584430-45584452 GTCAAAAATCGTGTTCCACATGG - Intronic
1108580310 13:51822632-51822654 GGCAGAGGGCTTGCTGCACAGGG - Intergenic
1108933847 13:55863510-55863532 GGCAAAAGGCATGTTTTATATGG - Intergenic
1109102107 13:58198757-58198779 GGCAAAAGGCATGTCTTACAGGG - Intergenic
1109150085 13:58836352-58836374 GGCAAAAGGCGTGTCTTACCTGG + Intergenic
1110018635 13:70440608-70440630 GGCAAAAGGCATGTCTTACATGG + Intergenic
1110044219 13:70809021-70809043 GGTAAAAGGCATGTCTCACATGG - Intergenic
1110250531 13:73376406-73376428 GGCAAAAGGCATGTCTTACATGG + Intergenic
1110543636 13:76733037-76733059 GGCAAAAGGCGTGTCTTACATGG + Intergenic
1111816758 13:93163497-93163519 GGCAAAAGGCATGTCTTACATGG + Intergenic
1111901278 13:94202419-94202441 GGCAAAAGGCATGTCCTACATGG + Intronic
1111943257 13:94636213-94636235 GGCAAAAGGCATGTCTTACATGG + Intergenic
1112783369 13:102926122-102926144 GGCAAAAGGCATGTCTTACATGG - Intergenic
1113003134 13:105666744-105666766 GGAAAAAGGCATGTCCCACATGG + Intergenic
1116316528 14:43402635-43402657 GGTAAAAGGCATGTTTTACATGG + Intergenic
1118057122 14:62090856-62090878 GGCAAAAGGCATGTCTTACATGG + Intronic
1118156529 14:63247884-63247906 GGCAAAGGGCATGTTTTACATGG + Intronic
1118402623 14:65393885-65393907 GGCAAAAGGCATGTCTTACATGG + Intergenic
1118481060 14:66166264-66166286 GGCAAAAGGCATGTCTTACATGG - Intergenic
1119142837 14:72283562-72283584 GGCAAAAGGCATGTCTTACATGG - Intronic
1120312684 14:82850958-82850980 GGCAAAAGGCATGTCTCACATGG - Intergenic
1120875283 14:89369625-89369647 GGCAAAAGGCATGTCTTACATGG + Intronic
1120916007 14:89711063-89711085 GGCGAAAGGCATGTCTCACATGG + Intergenic
1121174959 14:91884153-91884175 GGCACAAGGCGTGTAACACCCGG - Intronic
1121385547 14:93519984-93520006 GGCATAAAGAGTGTTGGACATGG - Intronic
1122380067 14:101296666-101296688 GGCAAAAGGCATGTCTTACATGG + Intergenic
1129868139 15:78924335-78924357 GGCAAGAGGAGTGTTTCAGAAGG + Intronic
1129900594 15:79145278-79145300 GGCAAAAGGCATGTTTTACATGG + Intergenic
1130015815 15:80185627-80185649 GGCAAAAGGCATGTCTTACATGG + Intronic
1131228188 15:90642345-90642367 GGCCAAAGTCGTGTTGCAGCAGG + Exonic
1131694989 15:94867416-94867438 GGCAAAAGGCATGTCTTACATGG + Intergenic
1131871178 15:96766532-96766554 GGCCAGAAGCATGTTGCACAAGG - Intergenic
1133096443 16:3449878-3449900 GGTAAAAGGCATGTCTCACATGG - Intronic
1133482425 16:6184036-6184058 GGCAAAAGGCATGTTTTACATGG + Intronic
1133601846 16:7347327-7347349 GGTAAAAGACATGTTTCACATGG + Intronic
1134416434 16:14047606-14047628 GGCAAAAGGCATGTCTTACATGG + Intergenic
1135893569 16:26378594-26378616 TGGAAAAGGCATGTTGCTCAAGG + Intergenic
1136287077 16:29250701-29250723 GGCAAAAGGCATGTCTTACATGG - Intergenic
1137016253 16:35378471-35378493 GGTAAAAGGCATGTCTCACATGG - Intergenic
1137775999 16:51054797-51054819 GGCAAAAGGTGTGTTTTACATGG + Intergenic
1140172065 16:72616028-72616050 GGTAAAAGGCATGTCTCACATGG + Intergenic
1140233997 16:73142214-73142236 GGCAAAAGGCCAGAGGCACAAGG - Intronic
1140632154 16:76866246-76866268 GGCAAAAGCCATGTCTCACATGG + Intergenic
1141739278 16:85879972-85879994 GGCAAAAGGGATTTTGCACATGG - Intergenic
1142092681 16:88223333-88223355 GGCAAAAGGCATGTCTTACATGG - Intergenic
1148145674 17:45363168-45363190 GGCAAAAGGCATGTCTTACATGG - Intergenic
1148640319 17:49182843-49182865 GGCAAAAGGCATGTCTCACATGG - Intergenic
1149131181 17:53304266-53304288 GGCAAAAGGCATGTCTTACATGG + Intergenic
1149672901 17:58431131-58431153 GGTGAAAGGCATGTTTCACATGG - Intronic
1150828835 17:68500401-68500423 GGCAAAAGGCATGTCTTACATGG - Intergenic
1151387198 17:73762313-73762335 GGCAGATGGCGTGGTGCAGATGG + Intergenic
1151498725 17:74475136-74475158 GGCAAAAGGCATGTCTTACATGG + Intronic
1152869029 17:82741637-82741659 TGCAAAGGTTGTGTTGCACAAGG + Intronic
1153994953 18:10432684-10432706 GGCGAGAGGCCTGTGGCACAGGG - Intergenic
1159282584 18:66306144-66306166 GGCAAAAGGCATGTCTTACATGG + Intergenic
1159850435 18:73520796-73520818 GGCGAAAGGCACGTTGTACATGG - Intergenic
1159931284 18:74315506-74315528 GGCTAACTGCGTGCTGCACAGGG - Intergenic
1163070548 19:14837093-14837115 GGCAAAAGGCATGTCTTACATGG + Intergenic
1164486561 19:28661033-28661055 GGCAAAAGGCCTGTTTTATACGG - Intergenic
1164530498 19:29044656-29044678 GGCAAAAGGCATGTCTTACATGG + Intergenic
1164841308 19:31394486-31394508 GGCAAAAGGCATTTCTCACATGG - Intergenic
1165030658 19:32995905-32995927 GGCACAAGGAGAGCTGCACAGGG - Intronic
1166252586 19:41581647-41581669 GGCAAAAGGCATGTCTTACATGG + Intronic
925120138 2:1411887-1411909 GGCAAAAGGGGCTTTGCAGATGG - Intronic
925850522 2:8077046-8077068 GGTAAAAGGCATGTCACACATGG + Intergenic
926365516 2:12129654-12129676 GGCAAAAGGAGTGTTGGAAGTGG - Intergenic
926638397 2:15208197-15208219 GGCAAAAGGCATGTCTTACATGG + Intronic
926938808 2:18114182-18114204 GGCAAAAGGCATGTCTTACATGG - Intronic
929344961 2:40870829-40870851 GGCAAAAGGCATGTTTTATATGG - Intergenic
929357981 2:41049804-41049826 GGTAAAAGGCATGTCTCACATGG - Intergenic
929358259 2:41051685-41051707 GGTGAAAGGCATGTTTCACATGG - Intergenic
932913658 2:75831762-75831784 GGCAAAAGGCTCATTTCACATGG - Intergenic
938953230 2:136276447-136276469 GGCAAAAGGCATGTCTTACATGG + Intergenic
939156030 2:138525174-138525196 GGCAAAAGGCATGTCTCACATGG + Intronic
940164884 2:150760117-150760139 GGCAAAAGGCATGTCTTACATGG - Intergenic
943193833 2:184718126-184718148 GGCAAAAGGCAAGTCTCACATGG + Intronic
943559863 2:189448065-189448087 GGCAAAAGGCATGTCTTACATGG - Intronic
944608925 2:201380436-201380458 GAGAAAAGGAATGTTGCACAAGG - Exonic
944800320 2:203232154-203232176 GGTGAAAGGCGTGTCTCACATGG - Intergenic
946122977 2:217532605-217532627 GGCAAAAGGCATGTCTTACATGG - Intronic
946844700 2:223849032-223849054 GGCGAAAGCCATGTTTCACATGG + Intergenic
947951495 2:234151852-234151874 GGCAAAAGGAATGTCTCACATGG + Intergenic
948413554 2:237783449-237783471 GGTGAAAGGCATGTTTCACATGG + Intronic
1168893260 20:1307735-1307757 GGCACAAAGCGTGTGGCAGAGGG - Exonic
1170741970 20:19066131-19066153 GGCAAAAGGCATGTCTTACATGG - Intergenic
1170751798 20:19154971-19154993 GGCAAAAGGCATGTTTTACATGG + Intergenic
1173072901 20:39786593-39786615 GGCAAAAGGCATGTCTTACATGG + Intergenic
1173365327 20:42379918-42379940 TTCAAAAGGCCTGTTGCAGAGGG + Intronic
1173548775 20:43917494-43917516 GACAAGAGGCTCGTTGCACAGGG + Intronic
1173946674 20:46956848-46956870 GGCAAAAGGCATGTCTTACATGG + Intronic
1175667618 20:60873549-60873571 GGCAAAAGGGGCTTTGCAGATGG - Intergenic
1177285297 21:19041325-19041347 GGCAAAAGGCATGTCTTACATGG + Intergenic
1177597296 21:23261562-23261584 GGCAAAAGGCATGTTCTACATGG - Intergenic
1178037271 21:28599343-28599365 GGCAAAAGGCATGTCTTACATGG + Intergenic
1178221706 21:30668214-30668236 GGTAAAAGGCATGTCTCACATGG - Intergenic
1178563531 21:33661817-33661839 GGCAAAAGGTATGTCTCACATGG - Intronic
1178603327 21:34013802-34013824 GGCAAAAGGCATGTCTTACATGG + Intergenic
1178975726 21:37219784-37219806 GGAAAAAGGGGGGTTGCAGAGGG - Intergenic
1182024785 22:27109577-27109599 GGCAAAAGGCACGTTTTACATGG + Intergenic
1182815326 22:33156983-33157005 GGTGAAAGGCGTGTCTCACATGG - Intergenic
1182905921 22:33936160-33936182 GGCAAAAGGAAGGTTGAACAGGG - Intergenic
1185414885 22:50704530-50704552 GGCAAAGGGAGTTTTGCAGAGGG + Intergenic
949881160 3:8661983-8662005 GGCAAAAGGCACGTTTTACATGG - Intronic
950133207 3:10561757-10561779 GGCAAAAGGCACGTCTCACATGG - Intronic
951526133 3:23654930-23654952 GGCAAAAAGACTGTTGCCCAGGG - Intergenic
952457423 3:33486722-33486744 GGCAAAAGGCATGTCTTACATGG + Intergenic
952644502 3:35639395-35639417 GGCAACGCGCGTGTTGCACGTGG - Intronic
953360672 3:42293470-42293492 GGCAAAAGGCATGTCTTACATGG - Intergenic
953850676 3:46463740-46463762 GGCGAGTGGCCTGTTGCACAGGG - Intronic
955773055 3:62405397-62405419 AGAAAAAGGCATGTTGCACAAGG - Intronic
956360305 3:68440238-68440260 GGTGAAAGGCATGTTTCACATGG - Intronic
958145875 3:89623810-89623832 GGCAAAAGGCGTGTCTTACATGG + Intergenic
959609434 3:108277480-108277502 GGCAAAAGGCATGTCTTACATGG + Intergenic
960243896 3:115378297-115378319 GGTAAAAGGCATGTCTCACATGG - Intergenic
961495968 3:127291648-127291670 GGCAAAAGGCATGTCTTACATGG - Intergenic
962157849 3:132967682-132967704 GGCGAAAGGCGTGTCTCACATGG + Intergenic
963022660 3:140886962-140886984 GGTAAAAGGCATGTCTCACAAGG - Intergenic
964894964 3:161584596-161584618 GGCAAAAGGGATTTTGCAGATGG - Intergenic
965013211 3:163124427-163124449 GGCAAAAGCCATGTCTCACAGGG + Intergenic
969083629 4:4639448-4639470 GGCAAAAGGTATGTCTCACATGG + Intergenic
969125568 4:4945451-4945473 GGCAAAAGGCATGTCTTACATGG + Intergenic
969685389 4:8671110-8671132 GGTAAAAGGCATGTCTCACATGG - Intergenic
970151679 4:13096795-13096817 GGCAAAAGGCATGTCTTACATGG + Intergenic
970363744 4:15337210-15337232 GGCAAAAGGCATGTCTTACATGG + Intergenic
970369508 4:15393172-15393194 GGCAAAAGGCATGTCTTACATGG - Intronic
970560722 4:17279684-17279706 GGCAAAAGGCATGTCTCACATGG + Intergenic
971262183 4:25067146-25067168 GGCAAAAGGCGCGTCTTACATGG - Intergenic
973063994 4:45764479-45764501 GGCAAAAGTCATGTCTCACATGG + Intergenic
974894645 4:67924652-67924674 GGCAAAAGGCATGTCTTACATGG + Intronic
976766837 4:88606638-88606660 GGTGAAAGGCATGTTTCACATGG + Intronic
977463791 4:97358011-97358033 GGCAAAAGGCATGTCTTACATGG + Intronic
977504075 4:97879450-97879472 GGCAAAAGGCATGTCTTACATGG + Intronic
977973203 4:103234081-103234103 GGCAGAAGGCATGTCTCACATGG - Intergenic
978358683 4:107905216-107905238 GGCAAAAGGCATGTTTTACATGG + Intronic
979079278 4:116313227-116313249 GGCAAAAGGCATGTCTTACAAGG + Intergenic
979856327 4:125638190-125638212 GGCAAAAGGCATGTCTTACAAGG + Intergenic
981580887 4:146247462-146247484 GGAAAAAGGGGTTTTGCAGATGG + Intergenic
981811501 4:148780760-148780782 GGCAAAAGGCATGTCCTACATGG + Intergenic
981871964 4:149497468-149497490 GGCAAAAGGCACGTCTCACATGG + Intergenic
982332518 4:154196935-154196957 GGCAAAAGGCATGTCTTACATGG - Intergenic
982795106 4:159635074-159635096 GGCAAAAGGCATGTCTTACATGG + Intergenic
984287319 4:177748079-177748101 GACAAATGGCCTCTTGCACATGG - Intronic
984513925 4:180714724-180714746 GGCAAAAGGCATGTCTTACATGG - Intergenic
984841425 4:184071473-184071495 GGCAAAAGGCATGTCCTACATGG + Intergenic
985808369 5:2065211-2065233 GGCAAAAGGCGTGTCTCACATGG - Intergenic
985852770 5:2400843-2400865 GGCAAAAGGCACGTCTCACATGG - Intergenic
985853085 5:2403040-2403062 GGCAAAAGGCATGTCTCACGTGG - Intergenic
986180933 5:5392384-5392406 GGCAAAAGGCATGTCTTACATGG - Intergenic
986409695 5:7464968-7464990 GGCAAAAGGCATGTCTTACATGG + Intronic
989108948 5:37888898-37888920 GGCAAAAGGAGCTTTGCAGATGG + Intergenic
990016872 5:51073836-51073858 GGTGAAAGGCATGTTTCACATGG + Intergenic
990238553 5:53794135-53794157 GGCAAAAGGCATGTCTTACATGG + Intergenic
990815937 5:59784938-59784960 GGCAAAAGGCATGTCTTACATGG - Intronic
993041323 5:82817985-82818007 GGTGAAAGGCGTGTCTCACACGG + Intergenic
994271363 5:97781942-97781964 GGTGAAAGGCATGTTTCACATGG + Intergenic
995909557 5:117169217-117169239 GGCGAAAGGCACGTTTCACATGG - Intergenic
996145547 5:119970966-119970988 GGCAAAAGGCGTATCTTACATGG + Intergenic
996200917 5:120672118-120672140 GGCACAAGGTGTGAAGCACACGG + Intronic
999750030 5:154621246-154621268 GGCAAAAGACGTGTCTTACATGG + Intergenic
1002964103 6:1945369-1945391 GGCAACAGGAGTGTGGCCCAAGG + Intronic
1003088476 6:3081047-3081069 TGGAAAAGGCGTGATACACAAGG + Exonic
1004522336 6:16373727-16373749 GGCAAAAGGCATGTCTTACATGG - Intronic
1004895856 6:20147101-20147123 GGCAAAAGGCATGTCTTACATGG - Intronic
1006826605 6:36940444-36940466 GGCAAAAGGAGTCTTGGAAAGGG + Intergenic
1009058769 6:58372172-58372194 GGCAAAAGGCATGTCTTACATGG + Intergenic
1010398417 6:75419572-75419594 GGCAAAAGGCCTGCTGCAAGTGG + Intronic
1010879749 6:81153058-81153080 GGTGAAAGGCATGTTTCACATGG + Intergenic
1010938431 6:81887834-81887856 GGCAGAAGGCTTGTTTTACATGG + Intergenic
1012660359 6:101882004-101882026 GGCAAAAGGCATGTCTCACATGG + Intronic
1013767642 6:113593422-113593444 GGCAAAAGGCATGTCTTACATGG + Intergenic
1014061256 6:117074191-117074213 GGTGAAAGGCATGTTTCACATGG - Intergenic
1014463020 6:121721020-121721042 GGTGAAAGGCATGTTTCACATGG - Intergenic
1014646204 6:123976072-123976094 GGCAAAAGGCACGTGGGACATGG - Intronic
1015226757 6:130865801-130865823 GGCAAAAGGCTAGGTGCACATGG + Intronic
1015453477 6:133397775-133397797 GGCAAAAGGCATGTGTCACATGG + Intronic
1015832626 6:137386703-137386725 GGCAAAAGGCATGTCTCACATGG + Intergenic
1016150672 6:140738073-140738095 GGTAAAAGGCATGTCTCACATGG + Intergenic
1016192898 6:141293046-141293068 GGCAGAAGGAGTGTTGGACAGGG - Intergenic
1016342461 6:143078586-143078608 GGCAAAAGGCATGTCTTACATGG + Intronic
1017430918 6:154369884-154369906 GGCAAAAGGGATGTTGCAGATGG - Intronic
1018473906 6:164121894-164121916 GGCAAAAGGCATGTCTTACATGG + Intergenic
1019000690 6:168747809-168747831 GGCAAAAGGCATGTCTTACATGG - Intergenic
1019150549 6:170002776-170002798 GGTGAAAGGCATGTTTCACATGG + Intergenic
1020022159 7:4875623-4875645 GGCAAAAAGCGAGTGGGACAGGG - Intronic
1021826041 7:24552346-24552368 GGCAAAAGGCATGTCTTACACGG - Intergenic
1022430657 7:30316515-30316537 GGTAAAACGCTTGTTGAACAAGG + Intronic
1024517388 7:50270448-50270470 GGCAAATGGGGTTTTGCAGATGG + Intergenic
1025110500 7:56212253-56212275 GGCAAAAGGCGTGTCTTACCTGG - Intergenic
1026320990 7:69267477-69267499 GGCAAAAGGCATGTCTTACATGG + Intergenic
1027748683 7:82112501-82112523 GGCAAAAGGCTTGATTCAGATGG - Intronic
1027881619 7:83845792-83845814 GGCAAAAGGCATGTCTTACATGG + Intergenic
1028024974 7:85826000-85826022 GGCAAAAGGGACTTTGCACATGG + Intergenic
1028624387 7:92862148-92862170 GGTAAAAGGCATGTCTCACATGG + Intergenic
1029114305 7:98229466-98229488 GGCCAGCGGCGTGTTTCACAGGG + Intronic
1029851590 7:103466857-103466879 GGCAAAAGGCACATCGCACATGG + Intergenic
1029859711 7:103556695-103556717 GGCAAAAGGCATGTCTTACATGG - Intronic
1030195736 7:106851783-106851805 GGCAAAAGGCATGTCTCACACGG + Intergenic
1032259243 7:130321659-130321681 GGCAAAAGGCATGTCTTACATGG + Intronic
1032432220 7:131871474-131871496 GGCAAAAGGCATGTCTTACATGG + Intergenic
1033521583 7:142166349-142166371 GGCAAAAGGCGTGTTGCACAGGG - Intronic
1036483946 8:9162970-9162992 GGCAAAAGGCATGTCTTACATGG + Intronic
1037592495 8:20324688-20324710 GGCAAAAGGCATGTCTTACATGG - Intergenic
1038051576 8:23818867-23818889 GGGAAAAGGCATGTTTTACATGG + Intergenic
1038500806 8:28042095-28042117 GGCAAAAGGCATGTCTTACATGG - Intronic
1038706432 8:29898246-29898268 GGCAAAAGGCATGTCTTACATGG + Intergenic
1039547240 8:38419044-38419066 GGCAAAAGGCACGTCTCACATGG - Intronic
1041225124 8:55690036-55690058 GGCTAAAGGCAGGTTTCACATGG - Intergenic
1043760093 8:84057574-84057596 GATAAAAGGCGTGTCTCACATGG - Intergenic
1044141895 8:88665887-88665909 GGCACCAGGGATGTTGCACACGG + Intergenic
1044928322 8:97228259-97228281 GGCAAAAGGCATGTCTTACATGG + Intergenic
1046175678 8:110572062-110572084 GGTAAAAGGCATGTTTTACATGG + Intergenic
1046723401 8:117648111-117648133 GGCAAAAGTCATGTTTTACATGG - Intergenic
1047586785 8:126281910-126281932 GGCAAAAGGCATGTCTTACATGG - Intergenic
1047732355 8:127737652-127737674 GGCAAAAGGAGTGTTGGACGGGG + Intronic
1048123440 8:131607322-131607344 GGCAAAAGGTATGTTTTACATGG + Intergenic
1050187625 9:2991761-2991783 GGCAAAAGGCATGTCTTACATGG + Intergenic
1051243218 9:15082154-15082176 GGCGAAAGGCATGTTTTACATGG + Intergenic
1055379518 9:75690725-75690747 GGCAAAAGGCATGTCTTACATGG + Intergenic
1056040889 9:82665827-82665849 GGTAAAAGGCATGTCTCACATGG - Intergenic
1056879603 9:90378720-90378742 GGCACAAGGCTTCTAGCACAAGG + Intergenic
1060595641 9:124846691-124846713 GGCAAAAGACATGTCTCACATGG + Intergenic
1186080286 X:5923554-5923576 GGTAAAAGGCATGTCTCACATGG + Intronic
1186156061 X:6728093-6728115 GGCAAAAGGCATGTGTTACATGG + Intergenic
1187196483 X:17090312-17090334 GGCTAAAGGCATGTCTCACATGG + Intronic
1187643542 X:21320300-21320322 GGCAAAAGGCATGTCTTACATGG + Intergenic
1187851038 X:23592035-23592057 GGCAAAAGGCACGTCTCACATGG - Intergenic
1188360406 X:29246186-29246208 TGCTAAAGGCATCTTGCACAAGG - Intronic
1188785217 X:34337131-34337153 GGTAAAAGGCATGTCTCACATGG + Intergenic
1189123345 X:38418781-38418803 GGCAAAAGGCATGCCTCACATGG - Intronic
1189711518 X:43817633-43817655 TACAAAAGCCGTGTTGCCCATGG - Intronic
1189845801 X:45135561-45135583 GGCAAAAGGCATGTCTTACATGG - Intergenic
1190239892 X:48649681-48649703 GGTAAAAGGCATGTTTTACATGG + Intergenic
1190516155 X:51225412-51225434 GGCAAAAGGCATGTCTTACATGG + Intergenic
1190561106 X:51686094-51686116 GGCAGAAGCAGTGTTGGACAGGG + Intergenic
1190563185 X:51707223-51707245 GGCAGAAGCAGTGTTGGACAGGG - Intergenic
1193226340 X:78988751-78988773 GGTAAAAGGCATGTCTCACATGG - Intergenic
1194330839 X:92581498-92581520 AGCAAAAGGCATGTTTTACATGG - Intronic
1197314043 X:124941886-124941908 GGCAAAAGGCATGTCTTACATGG + Intronic
1197454334 X:126659224-126659246 GGCAAAAGGCGTTTCTTACATGG - Intergenic
1197566643 X:128096019-128096041 GGCAAAAGGCATGCCTCACATGG + Intergenic
1198309104 X:135412704-135412726 GGCAAAAGGCATGTCTTACATGG - Intergenic
1198719166 X:139596598-139596620 TGCAAAAGGCGTGTTGAAAGTGG - Exonic
1199472395 X:148209519-148209541 GGCAAAAGGCATGTCTCTCATGG - Intergenic
1200639541 Y:5700569-5700591 AGCAAAAGGCATGTTTTACATGG - Intronic
1201683017 Y:16669945-16669967 GGCAGAAGGTGTTTTGCAAATGG + Intergenic
1201704493 Y:16921224-16921246 GGTAAAAGGCAAGTTTCACATGG + Intergenic