ID: 1033521584

View in Genome Browser
Species Human (GRCh38)
Location 7:142166350-142166372
Sequence TGGCAAAAGGCGTGTTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033521584_1033521586 -8 Left 1033521584 7:142166350-142166372 CCTGTGCAACACGCCTTTTGCCA 0: 1
1: 0
2: 1
3: 1
4: 65
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033521584 Original CRISPR TGGCAAAAGGCGTGTTGCAC AGG (reversed) Intronic
902956215 1:19925630-19925652 TGGCATAAGGGGTGTTTCCCAGG + Intergenic
906132070 1:43466327-43466349 TGGGAGAAGGTGTGTGGCACTGG - Intergenic
906160458 1:43645035-43645057 TGGCAAAAGCCACGTTGCAAAGG + Intergenic
908449003 1:64231785-64231807 AGGCATAAGGCATATTGCACTGG + Intronic
910830924 1:91462188-91462210 TGGCAAAAGAAGTGTGGCAGTGG - Intergenic
911525380 1:98978534-98978556 TGGCAAAAGATGTGTTCCAGGGG - Intronic
915313564 1:155016364-155016386 TGGCGAAAGCCTTGTGGCACAGG - Exonic
916106020 1:161433061-161433083 TGGCAAAAGCAGTGTGGCAGTGG - Intergenic
916642303 1:166743500-166743522 TGGCAAAAGGTCTGAGGCACAGG - Intergenic
924260827 1:242229089-242229111 TAGCAAAGAGCCTGTTGCACAGG + Intronic
1073331717 10:102674342-102674364 GGGGAAAGGGTGTGTTGCACTGG + Exonic
1077542613 11:3154372-3154394 TGGCTGACGGCGTGTGGCACAGG + Intronic
1080194421 11:29592222-29592244 GGGCAAAAGGACTGTTGCATTGG - Intergenic
1080975076 11:37329738-37329760 TGGCACAGGGGTTGTTGCACAGG + Intergenic
1089819733 11:121213542-121213564 TGGCAAAATGCGTGTGCAACCGG - Intergenic
1097386895 12:58960892-58960914 CGGCAAAAGGCCTGTTTCCCAGG + Intergenic
1100592048 12:96038405-96038427 TGGCAAATGTCCTGTTGCCCAGG + Intronic
1112491804 13:99872538-99872560 TGGCACAAGGCTTGTAGCAGAGG - Intronic
1112695494 13:101943684-101943706 TGGCAAAAGGCTGGGTGCAGTGG + Intronic
1128834334 15:70796961-70796983 TGGCAAAGGGCATGTTCCTCAGG + Intergenic
1133022032 16:2970987-2971009 GGGCAAAAGGCTTTTGGCACTGG - Intronic
1138179651 16:54932915-54932937 TGGGAAAGGGCGTGTTGGGCGGG + Intronic
1139276377 16:65731459-65731481 TGGCAAAGGGGGTTTTGCAGTGG + Intergenic
1148633370 17:49129127-49129149 TGGCAAAGGGCCTCTTGGACTGG + Intergenic
1154307302 18:13239972-13239994 TGGCATGAGGAGAGTTGCACGGG - Intronic
1157530159 18:48413546-48413568 TTGCAATAGGAGTGTTGCAATGG - Intergenic
1160606172 18:80051085-80051107 TGGCAAAGGGCCTGTTCCAGAGG + Intronic
1162790084 19:13058174-13058196 TGGCAAGAGGGGTTTTGCATGGG + Intronic
1164971111 19:32533276-32533298 TGGCAAAGGGTGTGTGGCTCCGG - Intergenic
1165030659 19:32995906-32995928 TGGCACAAGGAGAGCTGCACAGG - Intronic
929168669 2:38908950-38908972 TAGTAAAAAGCGTGTTTCACTGG + Intronic
944273345 2:197806410-197806432 TTGCAACATGCGTGATGCACTGG - Intronic
946756769 2:222955151-222955173 TGGCAAAAGGGGTGTTAGTCTGG + Intergenic
1168912873 20:1463889-1463911 TGGCAAAGGGTGGGTTACACAGG + Intronic
1169178373 20:3539808-3539830 TGGCAAAAGCTCTGTTGTACAGG - Intronic
1172593312 20:36132488-36132510 TGGCAAAAGGGACCTTGCACAGG - Intronic
1173365326 20:42379917-42379939 TTTCAAAAGGCCTGTTGCAGAGG + Intronic
1178975727 21:37219785-37219807 TGGAAAAAGGGGGGTTGCAGAGG - Intergenic
1182446691 22:30393778-30393800 TGGCAGAGGTCGTGTTGCATTGG + Intronic
1182905922 22:33936161-33936183 TGGCAAAAGGAAGGTTGAACAGG - Intergenic
951526134 3:23654931-23654953 TGGCAAAAAGACTGTTGCCCAGG - Intergenic
953850677 3:46463741-46463763 TGGCGAGTGGCCTGTTGCACAGG - Intronic
962164020 3:133030099-133030121 TGGAAAAGGGCATGTTTCACAGG - Intergenic
963060585 3:141221723-141221745 TAGCAAAAGGTCTGGTGCACAGG + Intergenic
966831807 3:184016865-184016887 TGGCAGGAGGAGAGTTGCACGGG + Intronic
972480710 4:39493290-39493312 TGGCACAGGGCGTGGTACACAGG - Intergenic
972806095 4:42530579-42530601 TGGCTAAAGACGTGTGGCAGTGG + Intronic
977783116 4:101002205-101002227 TGGCAAAAGGCTGGGTGCAGTGG - Intergenic
979577768 4:122315541-122315563 TGGCAAAAGGCTTAATGCTCTGG + Exonic
986998843 5:13638241-13638263 TGGCAAAGTGCATGTTGCTCAGG + Intergenic
994917110 5:105994675-105994697 TGGCAAAAGAAGTGTGGCAGTGG + Intergenic
1002596030 5:180323960-180323982 TGGCCAAAGGCCAGATGCACTGG - Intronic
1014422351 6:121261252-121261274 TGGCAGAGGGTGTGCTGCACTGG - Intronic
1015414306 6:132931421-132931443 TGGCAAAAATCGTGTTGCAAAGG + Intergenic
1016192899 6:141293047-141293069 AGGCAGAAGGAGTGTTGGACAGG - Intergenic
1019746216 7:2701698-2701720 TGCCGAAAGGCGTGGTGCGCTGG - Intronic
1020514686 7:9103060-9103082 TGGCAAAAGGCTTGTTGATTTGG + Intergenic
1027952161 7:84830739-84830761 TGTCAAATGTCGTGTTGCAGAGG + Intergenic
1033521584 7:142166350-142166372 TGGCAAAAGGCGTGTTGCACAGG - Intronic
1033568816 7:142606886-142606908 TGGCAAAGGGCTGGGTGCACTGG + Intergenic
1043327019 8:79064923-79064945 TGGCGCAAGACGTGTTTCACTGG + Intergenic
1047732354 8:127737651-127737673 TGGCAAAAGGAGTGTTGGACGGG + Intronic
1058964989 9:110028853-110028875 AGGCAAGAGGAGTGTTGCAAAGG + Intronic
1062204393 9:135327907-135327929 TGGAAAAAGGAGTGAAGCACTGG + Intergenic
1189064241 X:37789278-37789300 TGGCAAAAGGGATTTTGCAGAGG - Intronic
1190561105 X:51686093-51686115 TGGCAGAAGCAGTGTTGGACAGG + Intergenic
1190563186 X:51707224-51707246 TGGCAGAAGCAGTGTTGGACAGG - Intergenic
1199923114 X:152430478-152430500 TGGCAACTGGGGTGTTGCCCAGG + Intronic