ID: 1033521586

View in Genome Browser
Species Human (GRCh38)
Location 7:142166365-142166387
Sequence TTTTGCCAACTCTACATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033521582_1033521586 -1 Left 1033521582 7:142166343-142166365 CCAGGACCCTGTGCAACACGCCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data
1033521584_1033521586 -8 Left 1033521584 7:142166350-142166372 CCTGTGCAACACGCCTTTTGCCA 0: 1
1: 0
2: 1
3: 1
4: 65
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data
1033521583_1033521586 -7 Left 1033521583 7:142166349-142166371 CCCTGTGCAACACGCCTTTTGCC 0: 1
1: 0
2: 1
3: 27
4: 283
Right 1033521586 7:142166365-142166387 TTTTGCCAACTCTACATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033521586 Original CRISPR TTTTGCCAACTCTACATGAT AGG Intronic
No off target data available for this crispr