ID: 1033524645

View in Genome Browser
Species Human (GRCh38)
Location 7:142198515-142198537
Sequence TCTAACATGCTTCCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033524645 Original CRISPR TCTAACATGCTTCCCAGGAA AGG Intronic
901378681 1:8858125-8858147 TCAGACAGGCTCCCCAGGAAAGG + Intergenic
901510762 1:9717092-9717114 TCTCACCTTCTTCGCAGGAATGG - Exonic
901522736 1:9797781-9797803 TTTAACATTCCTGCCAGGAAAGG - Intronic
903959548 1:27047968-27047990 GACCACATGCTTCCCAGGAAAGG - Intergenic
904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG + Intergenic
906470565 1:46126662-46126684 GCTAACATGTTTGCCAGGCATGG + Intronic
906736076 1:48129742-48129764 TCTAAAAGGCTTCCCAAGAAAGG - Intergenic
907542851 1:55232424-55232446 TCAAACTTGCTTCAAAGGAAAGG + Intergenic
908776527 1:67646295-67646317 TCTAACATGCCTGCAAGGAGGGG + Intergenic
909266956 1:73571916-73571938 TCTGACATGCTTTCAAGGGAAGG - Intergenic
910274737 1:85436949-85436971 TAAGACATTCTTCCCAGGAATGG + Intronic
910814724 1:91279581-91279603 GCTAATATGGGTCCCAGGAAGGG - Intronic
913552495 1:119929252-119929274 TTTAACCTGCTTTCCAGCAAGGG + Intronic
913612696 1:120523870-120523892 TAGAACATTCTTCCCAGGGAAGG - Intergenic
914522637 1:148431709-148431731 TCTTTCACGCCTCCCAGGAAGGG - Intergenic
914883335 1:151564706-151564728 TCTAGCATCCCTGCCAGGAATGG + Intronic
915056833 1:153140742-153140764 TATAACAGGGTTCACAGGAAGGG + Intergenic
918652008 1:186976932-186976954 TATAACCAGCTTACCAGGAAGGG + Intronic
920080631 1:203370328-203370350 GCCTCCATGCTTCCCAGGAATGG - Intergenic
920548473 1:206838283-206838305 TCTAGAATACTTCCCAGGACTGG - Intronic
920924744 1:210330516-210330538 TCTAACCTACTTCCAAGGAGGGG - Intronic
921687418 1:218105701-218105723 TTTAACATTCTTCCCCTGAAAGG - Intergenic
922425910 1:225492547-225492569 TTTAACATGCTTCACAGAACGGG + Exonic
923336540 1:232975849-232975871 TCTAATTAGCTTCTCAGGAAAGG + Intronic
924558056 1:245134074-245134096 TATAACATACTTCCCTGGCAGGG - Intergenic
924832531 1:247613383-247613405 TACAACTTGCTTCACAGGAATGG - Intergenic
1064216665 10:13406286-13406308 TGGAACAAGCTTCTCAGGAAGGG - Intergenic
1066638564 10:37532632-37532654 TCTAACTTGGTACCCAGGAGAGG - Intergenic
1070707652 10:78652632-78652654 TGTAACATATTTCTCAGGAATGG + Intergenic
1072868982 10:99096634-99096656 ATTAAAATGTTTCCCAGGAATGG + Intronic
1074470622 10:113723341-113723363 TCTAACAGGCAACCCAGGCAAGG + Intronic
1075790381 10:125079970-125079992 TTTAGCATGGTTACCAGGAATGG - Intronic
1076118060 10:127914407-127914429 ACTATCATACTTCCCAGGATAGG + Intronic
1077369384 11:2174423-2174445 TGGGACAGGCTTCCCAGGAATGG - Intergenic
1079403057 11:20121781-20121803 TCTAACAAGCTCCACAGGAGTGG - Intergenic
1080353620 11:31415010-31415032 TGGAAAATGCTCCCCAGGAATGG - Intronic
1082701496 11:56437292-56437314 TTTAATATGCTTCCAAGTAAAGG + Intergenic
1087120559 11:94570010-94570032 TCTACCATCCTTCCAAGCAATGG - Intronic
1088402786 11:109439767-109439789 TCTTGCATGTTTCCCAGGGAGGG - Intergenic
1088549896 11:111002028-111002050 CACAACATGCTTCCAAGGAAGGG + Intergenic
1088866577 11:113853394-113853416 TCTAACATATATACCAGGAAAGG + Intronic
1090649882 11:128797068-128797090 TCTGAAATGCTTTGCAGGAAAGG - Intronic
1091252494 11:134155369-134155391 TCTAACAGTTCTCCCAGGAAGGG + Intronic
1091832286 12:3558155-3558177 TCTGTCCTGCTTGCCAGGAAAGG + Intronic
1093563836 12:20578159-20578181 TCTAATATGCTCCCCAGAGAAGG + Intronic
1094577694 12:31702688-31702710 TATTAGATGCTTACCAGGAAGGG + Intronic
1095876857 12:47088909-47088931 TCTTAGAGCCTTCCCAGGAAAGG - Intronic
1097184466 12:57189172-57189194 GTGAACCTGCTTCCCAGGAATGG - Intronic
1100062683 12:90600628-90600650 TATAACATGCTTCCTCTGAAAGG + Intergenic
1100850168 12:98701960-98701982 TTTAAAATGCTTCCCAAGATAGG - Intronic
1101163689 12:102006323-102006345 TGTACCATTTTTCCCAGGAAGGG + Intronic
1101945658 12:109134411-109134433 TCCTACATCCTCCCCAGGAAAGG - Intronic
1106259373 13:28051958-28051980 TGTAGCATGATGCCCAGGAAGGG + Intronic
1108579198 13:51814435-51814457 TCTAACCTGTTTCCCCAGAAGGG + Intergenic
1109587583 13:64427311-64427333 TATACCATTCTTCCCAGGAAAGG - Intergenic
1111986003 13:95067586-95067608 TCTAACATGTTTCCAAGCAGAGG + Intronic
1112295754 13:98185571-98185593 CCTATGCTGCTTCCCAGGAATGG - Intronic
1113016680 13:105835781-105835803 TCAAACATGCTCCCCACAAACGG + Intergenic
1114557141 14:23568476-23568498 TCTCACATGCTTCCCAGGCAGGG - Exonic
1114774502 14:25465947-25465969 GCTCCCATGCTTCCCAGGCAAGG + Intergenic
1115099861 14:29685599-29685621 TCTAACATATTTTCCAGTAAAGG + Intronic
1117102237 14:52361826-52361848 TCTAACATTTATACCAGGAAGGG + Intergenic
1117462285 14:55957133-55957155 TGTAAAATGTTTCCCATGAAAGG + Intergenic
1118020668 14:61710391-61710413 TCTAACACTCTTCCCAGAACAGG - Intronic
1118602417 14:67480250-67480272 CCTAACCTGCTTGACAGGAAGGG - Intronic
1118774107 14:68962621-68962643 TCTAACAGCCTTCCAAAGAAGGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1125809902 15:42529524-42529546 TATAGAATGTTTCCCAGGAATGG + Intronic
1126016060 15:44352038-44352060 TATGACATTCTTCCCAGAAATGG + Intronic
1128480308 15:68031857-68031879 TCTAATATGCTTTCATGGAAAGG - Intergenic
1130197170 15:81791349-81791371 TCCAACATACTTCCCAGCACTGG - Intergenic
1131371910 15:91889212-91889234 TCTAAAATTGTTGCCAGGAAAGG + Intronic
1131580916 15:93642253-93642275 TCTAACAAGCTTGCCAACAACGG + Intergenic
1133270262 16:4607883-4607905 CCGCACTTGCTTCCCAGGAATGG - Intergenic
1138749618 16:59402932-59402954 TTGAACATACTTCACAGGAAAGG - Intergenic
1140022903 16:71255705-71255727 TCTAATATGCTTCCTAGGGTGGG + Intergenic
1140116149 16:72043293-72043315 CCTAACGTGCTTCCCAGCCATGG + Intergenic
1140545245 16:75801644-75801666 TCCAACATGAGTCCCAGGGAAGG - Intergenic
1140924977 16:79573772-79573794 TTTAACAGGCTGTCCAGGAAAGG + Intergenic
1141342221 16:83213573-83213595 GCAATCATGCTTCCCAAGAATGG - Intronic
1141595197 16:85093019-85093041 TATCACATGCTCTCCAGGAAAGG + Exonic
1143548329 17:7613754-7613776 TCTACCATTCTACTCAGGAATGG - Intronic
1144208965 17:12999040-12999062 TCTATCCAGCTTCCCAGGAGGGG + Intronic
1144352802 17:14414666-14414688 TCTAACATTCTTATCAAGAATGG - Intergenic
1145116671 17:20216682-20216704 TCAAACAAACTTCCCAAGAAGGG - Intronic
1148289283 17:46429211-46429233 TCTCATATCCTTCCAAGGAAGGG - Intergenic
1148311452 17:46646783-46646805 TCTCATATCCTTCCAAGGAAGGG - Intronic
1148871571 17:50661538-50661560 TCTAACATCTGTCTCAGGAATGG + Intronic
1149103731 17:52937230-52937252 TCTGCCATACTCCCCAGGAATGG + Intergenic
1157322048 18:46642183-46642205 TCTGACATGGTTCCCAGGGGAGG + Intronic
1165378382 19:35460107-35460129 TAGAACATGACTCCCAGGAAGGG + Intergenic
1168367220 19:55798894-55798916 TCTATCATGCTTAGCAGTAAAGG + Intronic
925795997 2:7543426-7543448 TCTAGAATATTTCCCAGGAAAGG - Intergenic
929949147 2:46393136-46393158 TCCAGCATGCTCCCCAGGCATGG + Intergenic
930607022 2:53503217-53503239 TTTAGCCTGCTTCCCAGGATTGG - Intergenic
931288826 2:60854765-60854787 CCTATCATGCTTCTCAGGCAGGG + Intergenic
934768562 2:96894241-96894263 TCACACATACTTCCCAGGAGAGG + Intronic
935602235 2:104934386-104934408 TGATACAGGCTTCCCAGGAAGGG + Intergenic
938146083 2:128835849-128835871 TGGAACAGGCTTCTCAGGAATGG + Intergenic
939735485 2:145839217-145839239 TCTCACATGCTTCCTGGGAAGGG + Intergenic
940914069 2:159235208-159235230 TCTAACAAGCTTCCCGCGGATGG + Intergenic
942091123 2:172492256-172492278 TCAAACATGCTGCTCAGCAATGG - Intronic
942618952 2:177826827-177826849 TCTACCCTTCTTCTCAGGAAAGG + Intronic
943011722 2:182458252-182458274 TGTAACAAGCCTCCCAAGAAAGG + Intronic
945678958 2:212889823-212889845 ACTGACAGGCTTCCCAGTAAAGG - Intergenic
947289402 2:228555377-228555399 TATAACTTGTTTCTCAGGAAAGG - Intergenic
947334493 2:229067669-229067691 TCTAACATGCCTCCCCCGATAGG + Intronic
1169235597 20:3927598-3927620 TCTGACATCATTGCCAGGAACGG - Intronic
1173428660 20:42966240-42966262 TCTAACATGCTTGCCAACACTGG + Intronic
1174632533 20:51970456-51970478 TTTAAAAGGCTTCCCATGAAAGG - Intergenic
1174888651 20:54364617-54364639 TTTTACTTGCTTCTCAGGAAAGG + Intergenic
1174994560 20:55551415-55551437 TCTAACATCCTTCACAGTCAAGG - Intergenic
1175428507 20:58887021-58887043 ACTAACATGCGTCCTAGGCAAGG - Intronic
1175783574 20:61698435-61698457 TCTGACTTGCTTCCCCTGAATGG - Intronic
1176152089 20:63596661-63596683 TCTACCTTGCTTCCCAAGGAGGG - Intronic
1177552694 21:22646321-22646343 TGTAACATGCTTCACTGGTAGGG + Intergenic
1178529174 21:33360818-33360840 TCTAGCATGCTCCCTAGGGAAGG + Intergenic
1181852462 22:25759919-25759941 TCAAACTTGTTTCCCAGAAAAGG + Intronic
1182488745 22:30655560-30655582 TCTAGCATGTCTCCCAGAAATGG + Intronic
1182938094 22:34245791-34245813 TCTAACATGCAGCCAAGGTAAGG + Intergenic
1184874914 22:47268252-47268274 TTTGAGATGCTTCCAAGGAACGG + Intergenic
949894253 3:8757713-8757735 TCTCCCATCCTTGCCAGGAAGGG + Intronic
951114328 3:18842102-18842124 TCTGACATGCTTGGCAGGAAGGG + Intergenic
953007902 3:38995034-38995056 GCTAACAAGCTTGACAGGAAAGG + Intergenic
960428185 3:117535188-117535210 ATTAACATGCTTACCATGAATGG + Intergenic
961528345 3:127523478-127523500 TCTGACAAGCTCTCCAGGAAGGG + Intergenic
963106634 3:141653126-141653148 TCTAACATGCAGCCTTGGAAAGG - Intergenic
964213706 3:154256012-154256034 TCTAAACCTCTTCCCAGGAAGGG + Exonic
967620442 3:191627405-191627427 TCTATAATGCATGCCAGGAAGGG + Intergenic
967857922 3:194132289-194132311 GTTAACATGCTTCCCCGGGAAGG + Intergenic
971740220 4:30509744-30509766 TCTAATATGTTCCCCAGGGATGG - Intergenic
984815712 4:183834131-183834153 TGTTACTTGCTTCCCAGGAGAGG + Intergenic
985585044 5:726869-726891 TCTATCATTCTTGCCAGAAATGG + Intronic
985598548 5:811184-811206 TCTATCATTCTTGCCAGAAATGG + Intronic
986032175 5:3904988-3905010 TCACAGATGCTTCCCAGGGAGGG - Intergenic
986881831 5:12183708-12183730 TCTAACATGCTTCATAATAATGG - Intergenic
987694249 5:21307827-21307849 TCTTGCATGCTCCCCAGAAAAGG + Intergenic
990755419 5:59064089-59064111 TCTAGTATACTTACCAGGAAAGG + Intronic
991632597 5:68671391-68671413 CCTAAGATGCTACCCAGGCAGGG - Intergenic
991639638 5:68739585-68739607 TCTGACTTGTTTCCCAGGAAAGG + Intergenic
993821438 5:92622035-92622057 TATAAAATGATTCCCAGTAAAGG - Intergenic
996498131 5:124185573-124185595 TCTAATTTAATTCCCAGGAAAGG - Intergenic
999558934 5:152777712-152777734 TCTAATATACTTCCCATTAAAGG - Intergenic
1000064760 5:157685010-157685032 TCTAGCATGTCTCCCAGAAATGG + Intergenic
1000120061 5:158188808-158188830 TGAAACAGGCTGCCCAGGAATGG - Intergenic
1003871698 6:10409517-10409539 TTTAACATCATTCCCAGGACAGG + Intronic
1004085462 6:12443842-12443864 TCTTACCTGATTGCCAGGAAGGG + Intergenic
1005009871 6:21325593-21325615 TCTAGCATGCTTACCATGAACGG + Intergenic
1005556658 6:26992107-26992129 TCTTGCATGCTCCCCAGAAAAGG - Intergenic
1011795154 6:90945168-90945190 TGTATCAATCTTCCCAGGAAGGG - Intergenic
1014501798 6:122200453-122200475 TCTAACATGGTTCCAATCAATGG + Intergenic
1015940391 6:138444996-138445018 TTTAAAATGCTACTCAGGAAAGG - Intronic
1021878993 7:25075811-25075833 TCAAACATCATTGCCAGGAAAGG - Intergenic
1022014831 7:26340641-26340663 ACTGCCATGTTTCCCAGGAAGGG + Intronic
1022499500 7:30873572-30873594 TCTATCAGGCTCCCCAGGGAGGG + Intronic
1027549895 7:79577825-79577847 TCATACAGGCTTCCGAGGAATGG + Intergenic
1028947168 7:96593075-96593097 TCTATCATGTGGCCCAGGAATGG - Intronic
1029466214 7:100726568-100726590 TCTCACATCCATCCCAGGAGTGG - Intergenic
1030229094 7:107186869-107186891 TCTAACATGCTTTCTTGGATGGG + Intronic
1030900655 7:115119289-115119311 TCTAAGATATTTCCCAGGAAAGG + Intergenic
1033524645 7:142198515-142198537 TCTAACATGCTTCCCAGGAAAGG + Intronic
1033613605 7:142989608-142989630 TCTAATAGGGTGCCCAGGAAAGG + Intergenic
1037394000 8:18422924-18422946 TCTACCTTGCTTCCCAGGGATGG + Intergenic
1038080832 8:24134274-24134296 TCTCACATGCTGCCCAGAATTGG - Intergenic
1038698707 8:29829549-29829571 TCTATCCTGCTTCACTGGAACGG - Intergenic
1038987111 8:32823553-32823575 TCTAACAAGCTAGCCAGGAGTGG - Intergenic
1039892056 8:41692493-41692515 TCTAAGATGCTTCTCAAGAGGGG + Intronic
1040770389 8:50968277-50968299 TCTAATATGCTCCCCAGCCAGGG - Intergenic
1041211617 8:55557759-55557781 TCTAACATGTTTCTAAGAAATGG + Intergenic
1045136301 8:99222675-99222697 TCTAACATGTTTCCTTTGAATGG + Intronic
1047802171 8:128321427-128321449 CATATCTTGCTTCCCAGGAAGGG + Intergenic
1048323897 8:133424175-133424197 TCCAACATGCCTTCCTGGAAAGG + Intergenic
1048681484 8:136846420-136846442 TCAAACTAGCTTCCCAGCAATGG + Intergenic
1048754193 8:137717387-137717409 TCAACCTTGCATCCCAGGAATGG + Intergenic
1052097232 9:24397697-24397719 TGAAAAATGCTTCCCAGGCATGG - Intergenic
1054594673 9:67052650-67052672 TATATTATGTTTCCCAGGAAAGG - Intergenic
1058190702 9:101911740-101911762 TCTATCCTCCTTCTCAGGAAGGG - Intergenic
1059434883 9:114270158-114270180 TCTCACATGGTTGCCAGGTATGG + Intronic
1059679889 9:116575992-116576014 TGTAAAATGCTTCCCAGGTTGGG - Intronic
1060504333 9:124187017-124187039 TCTAACAAGACTCCCAGGAGTGG + Intergenic
1061940988 9:133883699-133883721 TCTTGCATGCTTCCCATGACAGG + Intronic
1062008716 9:134255692-134255714 TCTAAAATGCTGCCCAGGTGCGG - Intergenic
1185917455 X:4051488-4051510 TCTGAGTTCCTTCCCAGGAAAGG + Intergenic
1187311271 X:18145597-18145619 TTTGACATTCTTCCCTGGAATGG - Intergenic
1192881934 X:75294904-75294926 TGTAAGATGCTTCCCTGAAAGGG + Intronic
1196458651 X:115907431-115907453 TCTACCATGCTTGGTAGGAAAGG - Intergenic
1198227004 X:134654318-134654340 TCTAACAAGCTTTCCAGCTAGGG - Intronic
1199295027 X:146147241-146147263 TCCAACAAGCTTCCCAGTAATGG + Intergenic
1199609752 X:149602523-149602545 TCTAACATTCCACCCATGAAGGG - Intronic