ID: 1033532570

View in Genome Browser
Species Human (GRCh38)
Location 7:142280003-142280025
Sequence AAATGATTTGACTCCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532570_1033532572 2 Left 1033532570 7:142280003-142280025 CCAGGACTGGAGTCAAATCATTT No data
Right 1033532572 7:142280028-142280050 AACTCTACTCCGTTTTCTAATGG No data
1033532570_1033532573 9 Left 1033532570 7:142280003-142280025 CCAGGACTGGAGTCAAATCATTT No data
Right 1033532573 7:142280035-142280057 CTCCGTTTTCTAATGGTGATAGG No data
1033532570_1033532575 30 Left 1033532570 7:142280003-142280025 CCAGGACTGGAGTCAAATCATTT No data
Right 1033532575 7:142280056-142280078 GGTGAAGCAAGTATGCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532570 Original CRISPR AAATGATTTGACTCCAGTCC TGG (reversed) Intergenic