ID: 1033532571

View in Genome Browser
Species Human (GRCh38)
Location 7:142280026-142280048
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532571_1033532578 25 Left 1033532571 7:142280026-142280048 CCAACTCTACTCCGTTTTCTAAT No data
Right 1033532578 7:142280074-142280096 AGAGGGTGATTCTGCCTGAGTGG No data
1033532571_1033532575 7 Left 1033532571 7:142280026-142280048 CCAACTCTACTCCGTTTTCTAAT No data
Right 1033532575 7:142280056-142280078 GGTGAAGCAAGTATGCCAAGAGG No data
1033532571_1033532576 8 Left 1033532571 7:142280026-142280048 CCAACTCTACTCCGTTTTCTAAT No data
Right 1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532571 Original CRISPR ATTAGAAAACGGAGTAGAGT TGG (reversed) Intergenic