ID: 1033532571 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:142280026-142280048 |
| Sequence | ATTAGAAAACGGAGTAGAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033532571_1033532576 | 8 | Left | 1033532571 | 7:142280026-142280048 | CCAACTCTACTCCGTTTTCTAAT | No data | ||
| Right | 1033532576 | 7:142280057-142280079 | GTGAAGCAAGTATGCCAAGAGGG | No data | ||||
| 1033532571_1033532575 | 7 | Left | 1033532571 | 7:142280026-142280048 | CCAACTCTACTCCGTTTTCTAAT | No data | ||
| Right | 1033532575 | 7:142280056-142280078 | GGTGAAGCAAGTATGCCAAGAGG | No data | ||||
| 1033532571_1033532578 | 25 | Left | 1033532571 | 7:142280026-142280048 | CCAACTCTACTCCGTTTTCTAAT | No data | ||
| Right | 1033532578 | 7:142280074-142280096 | AGAGGGTGATTCTGCCTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033532571 | Original CRISPR | ATTAGAAAACGGAGTAGAGT TGG (reversed) | Intergenic | ||