ID: 1033532574

View in Genome Browser
Species Human (GRCh38)
Location 7:142280037-142280059
Sequence CACCTATCACCATTAGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532574_1033532580 21 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532580 7:142280081-142280103 GATTCTGCCTGAGTGGTTCCGGG No data
1033532574_1033532576 -3 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG No data
1033532574_1033532579 20 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532579 7:142280080-142280102 TGATTCTGCCTGAGTGGTTCCGG No data
1033532574_1033532578 14 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532578 7:142280074-142280096 AGAGGGTGATTCTGCCTGAGTGG No data
1033532574_1033532575 -4 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532575 7:142280056-142280078 GGTGAAGCAAGTATGCCAAGAGG No data
1033532574_1033532581 22 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532581 7:142280082-142280104 ATTCTGCCTGAGTGGTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532574 Original CRISPR CACCTATCACCATTAGAAAA CGG (reversed) Intergenic