ID: 1033532576

View in Genome Browser
Species Human (GRCh38)
Location 7:142280057-142280079
Sequence GTGAAGCAAGTATGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532571_1033532576 8 Left 1033532571 7:142280026-142280048 CCAACTCTACTCCGTTTTCTAAT No data
Right 1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG No data
1033532574_1033532576 -3 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532576 Original CRISPR GTGAAGCAAGTATGCCAAGA GGG Intergenic
No off target data available for this crispr