ID: 1033532576 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:142280057-142280079 |
Sequence | GTGAAGCAAGTATGCCAAGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1033532574_1033532576 | -3 | Left | 1033532574 | 7:142280037-142280059 | CCGTTTTCTAATGGTGATAGGTG | No data | ||
Right | 1033532576 | 7:142280057-142280079 | GTGAAGCAAGTATGCCAAGAGGG | No data | ||||
1033532571_1033532576 | 8 | Left | 1033532571 | 7:142280026-142280048 | CCAACTCTACTCCGTTTTCTAAT | No data | ||
Right | 1033532576 | 7:142280057-142280079 | GTGAAGCAAGTATGCCAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1033532576 | Original CRISPR | GTGAAGCAAGTATGCCAAGA GGG | Intergenic | ||