ID: 1033532578

View in Genome Browser
Species Human (GRCh38)
Location 7:142280074-142280096
Sequence AGAGGGTGATTCTGCCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532571_1033532578 25 Left 1033532571 7:142280026-142280048 CCAACTCTACTCCGTTTTCTAAT No data
Right 1033532578 7:142280074-142280096 AGAGGGTGATTCTGCCTGAGTGG No data
1033532574_1033532578 14 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532578 7:142280074-142280096 AGAGGGTGATTCTGCCTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532578 Original CRISPR AGAGGGTGATTCTGCCTGAG TGG Intergenic