ID: 1033532580

View in Genome Browser
Species Human (GRCh38)
Location 7:142280081-142280103
Sequence GATTCTGCCTGAGTGGTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033532574_1033532580 21 Left 1033532574 7:142280037-142280059 CCGTTTTCTAATGGTGATAGGTG No data
Right 1033532580 7:142280081-142280103 GATTCTGCCTGAGTGGTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033532580 Original CRISPR GATTCTGCCTGAGTGGTTCC GGG Intergenic