ID: 1033534417

View in Genome Browser
Species Human (GRCh38)
Location 7:142298815-142298837
Sequence GGCACTGGCACCTCAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033534417_1033534420 -10 Left 1033534417 7:142298815-142298837 CCACCTCTTGAGGTGCCAGTGCC No data
Right 1033534420 7:142298828-142298850 TGCCAGTGCCAAGCTTGGAAAGG No data
1033534417_1033534422 -3 Left 1033534417 7:142298815-142298837 CCACCTCTTGAGGTGCCAGTGCC No data
Right 1033534422 7:142298835-142298857 GCCAAGCTTGGAAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033534417 Original CRISPR GGCACTGGCACCTCAAGAGG TGG (reversed) Intergenic
No off target data available for this crispr