ID: 1033537933

View in Genome Browser
Species Human (GRCh38)
Location 7:142329026-142329048
Sequence AGGGAGAGACAACATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033537933_1033537942 5 Left 1033537933 7:142329026-142329048 CCACCCTCATGTTGTCTCTCCCT No data
Right 1033537942 7:142329054-142329076 CCATGTTGCTTCTTCTCTCTAGG No data
1033537933_1033537943 6 Left 1033537933 7:142329026-142329048 CCACCCTCATGTTGTCTCTCCCT No data
Right 1033537943 7:142329055-142329077 CATGTTGCTTCTTCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033537933 Original CRISPR AGGGAGAGACAACATGAGGG TGG (reversed) Intergenic
No off target data available for this crispr