ID: 1033539773

View in Genome Browser
Species Human (GRCh38)
Location 7:142345681-142345703
Sequence GTTTCCATGGGGACTGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033539773_1033539784 12 Left 1033539773 7:142345681-142345703 CCCCCCGCAGTCCCCATGGAAAC No data
Right 1033539784 7:142345716-142345738 GACACCAAGACACCTGGTCATGG No data
1033539773_1033539785 13 Left 1033539773 7:142345681-142345703 CCCCCCGCAGTCCCCATGGAAAC No data
Right 1033539785 7:142345717-142345739 ACACCAAGACACCTGGTCATGGG No data
1033539773_1033539783 6 Left 1033539773 7:142345681-142345703 CCCCCCGCAGTCCCCATGGAAAC No data
Right 1033539783 7:142345710-142345732 TACGCAGACACCAAGACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033539773 Original CRISPR GTTTCCATGGGGACTGCGGG GGG (reversed) Intergenic
No off target data available for this crispr