ID: 1033542474

View in Genome Browser
Species Human (GRCh38)
Location 7:142369605-142369627
Sequence AGGGAGAGTGCAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542474_1033542480 14 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542474_1033542482 25 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542474_1033542483 26 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542483 7:142369654-142369676 AAGCCATATGGCCACTGCCAGGG No data
1033542474_1033542484 27 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542474 Original CRISPR AGGGAGAGTGCAGTGACTGT GGG (reversed) Intergenic
No off target data available for this crispr