ID: 1033542476

View in Genome Browser
Species Human (GRCh38)
Location 7:142369624-142369646
Sequence CAGTCTGTGCATTTGGGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542476_1033542487 13 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542487 7:142369660-142369682 TATGGCCACTGCCAGGGGATGGG No data
1033542476_1033542494 29 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542494 7:142369676-142369698 GGATGGGGGAGGCATGGTATTGG No data
1033542476_1033542483 7 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542483 7:142369654-142369676 AAGCCATATGGCCACTGCCAGGG No data
1033542476_1033542488 14 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542476_1033542489 15 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717
1033542476_1033542492 23 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542492 7:142369670-142369692 GCCAGGGGATGGGGGAGGCATGG No data
1033542476_1033542491 18 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542476_1033542484 8 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG No data
1033542476_1033542480 -5 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542476_1033542482 6 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542476_1033542486 12 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542486 7:142369659-142369681 ATATGGCCACTGCCAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542476 Original CRISPR CAGTCTGTGCATTTGGGTTA GGG (reversed) Intergenic
No off target data available for this crispr