ID: 1033542478

View in Genome Browser
Species Human (GRCh38)
Location 7:142369630-142369652
Sequence GAGAGACAGTCTGTGCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542478_1033542486 6 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542486 7:142369659-142369681 ATATGGCCACTGCCAGGGGATGG No data
1033542478_1033542487 7 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542487 7:142369660-142369682 TATGGCCACTGCCAGGGGATGGG No data
1033542478_1033542483 1 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542483 7:142369654-142369676 AAGCCATATGGCCACTGCCAGGG No data
1033542478_1033542488 8 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542478_1033542492 17 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542492 7:142369670-142369692 GCCAGGGGATGGGGGAGGCATGG No data
1033542478_1033542489 9 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG No data
1033542478_1033542491 12 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542478_1033542484 2 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG No data
1033542478_1033542482 0 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542478_1033542494 23 Left 1033542478 7:142369630-142369652 CCCAAATGCACAGACTGTCTCTC No data
Right 1033542494 7:142369676-142369698 GGATGGGGGAGGCATGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542478 Original CRISPR GAGAGACAGTCTGTGCATTT GGG (reversed) Intergenic