ID: 1033542479

View in Genome Browser
Species Human (GRCh38)
Location 7:142369631-142369653
Sequence GGAGAGACAGTCTGTGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542479_1033542494 22 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542494 7:142369676-142369698 GGATGGGGGAGGCATGGTATTGG No data
1033542479_1033542492 16 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542492 7:142369670-142369692 GCCAGGGGATGGGGGAGGCATGG No data
1033542479_1033542484 1 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542484 7:142369655-142369677 AGCCATATGGCCACTGCCAGGGG No data
1033542479_1033542491 11 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542491 7:142369665-142369687 CCACTGCCAGGGGATGGGGGAGG No data
1033542479_1033542487 6 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542487 7:142369660-142369682 TATGGCCACTGCCAGGGGATGGG No data
1033542479_1033542489 8 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542489 7:142369662-142369684 TGGCCACTGCCAGGGGATGGGGG 0: 6
1: 16
2: 55
3: 130
4: 717
1033542479_1033542482 -1 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542482 7:142369653-142369675 CAAGCCATATGGCCACTGCCAGG No data
1033542479_1033542486 5 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542486 7:142369659-142369681 ATATGGCCACTGCCAGGGGATGG No data
1033542479_1033542488 7 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542488 7:142369661-142369683 ATGGCCACTGCCAGGGGATGGGG No data
1033542479_1033542483 0 Left 1033542479 7:142369631-142369653 CCAAATGCACAGACTGTCTCTCC No data
Right 1033542483 7:142369654-142369676 AAGCCATATGGCCACTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542479 Original CRISPR GGAGAGACAGTCTGTGCATT TGG (reversed) Intergenic
No off target data available for this crispr