ID: 1033542480

View in Genome Browser
Species Human (GRCh38)
Location 7:142369642-142369664
Sequence GACTGTCTCTCCAAGCCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033542475_1033542480 13 Left 1033542475 7:142369606-142369628 CCACAGTCACTGCACTCTCCCTA No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542477_1033542480 -6 Left 1033542477 7:142369625-142369647 CCTAACCCAAATGCACAGACTGT No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542476_1033542480 -5 Left 1033542476 7:142369624-142369646 CCCTAACCCAAATGCACAGACTG No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542473_1033542480 26 Left 1033542473 7:142369593-142369615 CCAACACAAAGTCCCACAGTCAC No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data
1033542474_1033542480 14 Left 1033542474 7:142369605-142369627 CCCACAGTCACTGCACTCTCCCT No data
Right 1033542480 7:142369642-142369664 GACTGTCTCTCCAAGCCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033542480 Original CRISPR GACTGTCTCTCCAAGCCATA TGG Intergenic
No off target data available for this crispr